ID: 1034410799

View in Genome Browser
Species Human (GRCh38)
Location 7:150941150-150941172
Sequence ACATTGCCAGTGAAGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034410794_1034410799 27 Left 1034410794 7:150941100-150941122 CCTTGGTTGTGCTAAAGTAAAAA No data
Right 1034410799 7:150941150-150941172 ACATTGCCAGTGAAGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034410799 Original CRISPR ACATTGCCAGTGAAGGAGTG GGG Intergenic
No off target data available for this crispr