ID: 1034411867

View in Genome Browser
Species Human (GRCh38)
Location 7:150946238-150946260
Sequence CATGCAGGTCCACCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034411863_1034411867 -6 Left 1034411863 7:150946221-150946243 CCTGCAGAGGCCAGGAACATGCA 0: 2
1: 0
2: 6
3: 38
4: 359
Right 1034411867 7:150946238-150946260 CATGCAGGTCCACCCAGGAGAGG No data
1034411862_1034411867 -2 Left 1034411862 7:150946217-150946239 CCATCCTGCAGAGGCCAGGAACA 0: 1
1: 0
2: 4
3: 15
4: 290
Right 1034411867 7:150946238-150946260 CATGCAGGTCCACCCAGGAGAGG No data
1034411858_1034411867 28 Left 1034411858 7:150946187-150946209 CCATGGACGCGGAGGTTGACACA 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1034411867 7:150946238-150946260 CATGCAGGTCCACCCAGGAGAGG No data
1034411861_1034411867 1 Left 1034411861 7:150946214-150946236 CCGCCATCCTGCAGAGGCCAGGA 0: 1
1: 0
2: 6
3: 124
4: 1613
Right 1034411867 7:150946238-150946260 CATGCAGGTCCACCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034411867 Original CRISPR CATGCAGGTCCACCCAGGAG AGG Intronic
No off target data available for this crispr