ID: 1034414755

View in Genome Browser
Species Human (GRCh38)
Location 7:150958534-150958556
Sequence GATCGCGAGCAGCCCCGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034414749_1034414755 9 Left 1034414749 7:150958502-150958524 CCTGCGGGAGAGGAGAGGCACGT 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1034414755 7:150958534-150958556 GATCGCGAGCAGCCCCGGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034414755 Original CRISPR GATCGCGAGCAGCCCCGGAG CGG Intronic
900353464 1:2248251-2248273 GAGTCCGGGCAGCCCCGGAGAGG - Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
903931253 1:26863758-26863780 GATCGCCAACAGCCCCGAGGAGG + Exonic
923041641 1:230323890-230323912 GGTGGCGCACAGCCCCGGAGTGG + Intronic
1063077761 10:2733389-2733411 GATGGGGGGCAGCCCTGGAGGGG + Intergenic
1066065895 10:31760479-31760501 GAGCGCGAGCAGCCTCGGCAGGG + Intergenic
1068136444 10:52954382-52954404 GTTGGCGAGTAGCCACGGAGGGG + Intergenic
1075527216 10:123197076-123197098 GATCTCTAGCAGACCCAGAGAGG - Intergenic
1081639727 11:44744559-44744581 GATGGCAAACAGGCCCGGAGAGG - Intronic
1083665442 11:64271695-64271717 GAGCGCGAGCGGCCCCGAAAGGG + Exonic
1090238109 11:125164460-125164482 GCTCGCGAGGAGCCTCGGATGGG - Intergenic
1092728639 12:11508251-11508273 GATCGCCACCTGCCCCGCAGTGG + Intergenic
1111620322 13:90716691-90716713 GATGGAAAGCAGCCCCAGAGTGG - Intergenic
1133386995 16:5377698-5377720 GAAGGCGTGCAGCCCAGGAGAGG + Intergenic
1143177855 17:4966963-4966985 CAACACGAGCAGCCCCGGGGAGG + Intronic
1144759702 17:17700428-17700450 GTTCGCGCGCAGCCCCTGCGGGG + Intronic
1154156423 18:11947781-11947803 GATTGGGAGGAGCCCCAGAGGGG - Intergenic
1157386153 18:47261208-47261230 GATCGCGAGCAGGAACGCAGAGG - Intergenic
1161579562 19:5073363-5073385 GAGAGCCAGCAGCCCCGGTGGGG + Intronic
1166921440 19:46231514-46231536 CATCGGGAGCAGCCCAGGTGGGG + Intergenic
927606681 2:24491898-24491920 GAGGGCGAGCATCCGCGGAGGGG + Intronic
930024490 2:47021888-47021910 GATGGTGATCAGCCTCGGAGAGG + Exonic
942083960 2:172427602-172427624 GGTCGCGAGCTGCCCGCGAGGGG + Intronic
1175973375 20:62698448-62698470 GAGGGGGAGCAGCCACGGAGGGG + Intergenic
1178453662 21:32727805-32727827 GACCGCGAGCAGCCGGGGTGCGG - Intronic
1181169950 22:21002371-21002393 GTTCGGGAGCGGCCCGGGAGCGG + Intergenic
1182057635 22:27372464-27372486 GCTCCCCAGCAGCCCCAGAGAGG + Intergenic
1184510599 22:44930946-44930968 GATACCCAGCAGCTCCGGAGAGG + Intronic
959733298 3:109628681-109628703 GATGGAGAGCAGACCTGGAGGGG + Intergenic
966390942 3:179451606-179451628 GAGCGCGCGCAGCCCGGGCGGGG + Intergenic
967904145 3:194486926-194486948 GATCGGGCGCCGCCGCGGAGGGG - Intronic
969615831 4:8252153-8252175 GGTCGCCAGCAGCCTGGGAGGGG - Intergenic
970600815 4:17639660-17639682 GATGGAGAGCAGCCCTGCAGGGG + Intronic
974016836 4:56655967-56655989 GACCGCGAGCGGCCCCACAGAGG - Exonic
980809198 4:137853569-137853591 GACCTCGACCAGCCCCAGAGAGG - Intergenic
981010606 4:139921369-139921391 GATAGTGAGCAGCTCAGGAGAGG - Intronic
985640866 5:1062975-1062997 GACCGCCAGCAGGACCGGAGGGG + Intronic
999151989 5:149432467-149432489 GATCGTGACCAGTCACGGAGTGG - Intergenic
1002291804 5:178205252-178205274 GCGCGCGAGCGGCCCCGGGGCGG - Intronic
1004827636 6:19440789-19440811 GATCGGGAGAAGCCCCATAGTGG + Intergenic
1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG + Intronic
1016416951 6:143843233-143843255 GATCGCGAGAAGCCACCGGGAGG - Intronic
1020009305 7:4799706-4799728 GCTCCCGGGCAGCCCCGCAGCGG - Exonic
1026822123 7:73557090-73557112 AATAGCGAGTAGCCCTGGAGTGG - Intronic
1027232645 7:76281675-76281697 GAGCGCGACGAGCCCCGGGGGGG - Exonic
1034414755 7:150958534-150958556 GATCGCGAGCAGCCCCGGAGCGG + Intronic
1034627309 7:152503516-152503538 GCTCCCGAGCACCCCCGGTGGGG - Intergenic
1034895864 7:154875966-154875988 GATGGTGAGCAGCCACGGCGCGG + Exonic
1035185076 7:157120182-157120204 GAGTGCGGGCAGCCCTGGAGTGG + Intergenic
1038828486 8:31032959-31032981 GAGCGCGGGCAGAGCCGGAGCGG - Exonic
1061293600 9:129665845-129665867 GCCCGCGAGCGGCCCCGGGGGGG - Exonic