ID: 1034415487

View in Genome Browser
Species Human (GRCh38)
Location 7:150962295-150962317
Sequence TTCGAGGGCCTGGCTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034415487_1034415492 -5 Left 1034415487 7:150962295-150962317 CCACAGCCAGCCAGGCCCTCGAA 0: 1
1: 0
2: 1
3: 22
4: 262
Right 1034415492 7:150962313-150962335 TCGAACCTAAGTCCTCCACCAGG 0: 1
1: 0
2: 0
3: 2
4: 36
1034415487_1034415493 -4 Left 1034415487 7:150962295-150962317 CCACAGCCAGCCAGGCCCTCGAA 0: 1
1: 0
2: 1
3: 22
4: 262
Right 1034415493 7:150962314-150962336 CGAACCTAAGTCCTCCACCAGGG No data
1034415487_1034415499 25 Left 1034415487 7:150962295-150962317 CCACAGCCAGCCAGGCCCTCGAA 0: 1
1: 0
2: 1
3: 22
4: 262
Right 1034415499 7:150962343-150962365 CCTCAGAGAAGTCTAGAGTCTGG 0: 1
1: 0
2: 2
3: 16
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034415487 Original CRISPR TTCGAGGGCCTGGCTGGCTG TGG (reversed) Intronic
900096874 1:943342-943364 GTGGGGGGCCTGTCTGGCTGTGG + Exonic
900126331 1:1070469-1070491 TCCCAGGGCCAGCCTGGCTGGGG - Intergenic
900186906 1:1336959-1336981 CTGGAGGGCGTGGCTGGCTGGGG + Intronic
900498415 1:2987488-2987510 TTCAAGGGCCTGGTTGGTCGGGG - Intergenic
900539617 1:3196310-3196332 TTCCAGGGCCCGGCTGGGTCAGG - Intronic
901058366 1:6460201-6460223 CACCAGGGCCTGGCTGGCTGGGG - Exonic
901198792 1:7455067-7455089 ATCCAGGGCCGGCCTGGCTGGGG + Intronic
901742605 1:11352167-11352189 CTGGTAGGCCTGGCTGGCTGGGG + Intergenic
902387779 1:16085629-16085651 TTCCAGGGCCTGGCTGGGCCAGG + Intergenic
902617760 1:17633127-17633149 TTCTGGGGCCTGGCTGCCTGAGG + Intronic
902958224 1:19941599-19941621 TTCTAGGCACTGGCGGGCTGGGG - Intergenic
903331091 1:22597598-22597620 TCCAAGGGCCTGGGAGGCTGGGG + Intronic
903513776 1:23896156-23896178 GTCTAGGGCCTGGCAGGGTGTGG - Intronic
903542637 1:24105564-24105586 TTCCAGCCCCAGGCTGGCTGCGG + Intronic
904411120 1:30325478-30325500 TCCCATGGCCTGGCTGGGTGGGG - Intergenic
904665668 1:32119319-32119341 ATGTAGGGCCTGGCTGGGTGTGG - Intronic
905006502 1:34714203-34714225 TTCTAGGTTCTGGCTGGCTCAGG - Intronic
907129432 1:52082442-52082464 TTAGAGGAACTGGCTGGGTGTGG + Intronic
912491570 1:110065372-110065394 TCCCAGGGCCAGGCAGGCTGTGG + Intronic
912717138 1:111990452-111990474 TTCGGGGGCGTGTGTGGCTGGGG + Intergenic
914919401 1:151837529-151837551 TTCGGGGGCCTTGTTGGCCGGGG + Intergenic
915267440 1:154729094-154729116 ACCGAGGGCCTGGCTAACTGTGG + Intronic
917927833 1:179803855-179803877 ATGGGGGGCCTGGCTGGGTGCGG - Intronic
919417227 1:197326375-197326397 TTGGGAGGCCTGGATGGCTGAGG + Intronic
922220133 1:223552145-223552167 TGCCAGGGCCTGGCTAGCGGAGG - Intronic
922751822 1:228073642-228073664 TGGGAGGGCAAGGCTGGCTGTGG - Intergenic
924222735 1:241894903-241894925 TTAGAGGGCTGGGCTGGGTGCGG - Intronic
1063455872 10:6182458-6182480 TCCTAGGGCCGAGCTGGCTGGGG + Intronic
1066101696 10:32123281-32123303 TTTCAGGGCCTGGTGGGCTGAGG + Intergenic
1067048757 10:43000249-43000271 TGGGAGGCCCAGGCTGGCTGTGG - Intergenic
1067323376 10:45243749-45243771 TTACAGGCCCTGGCTGGCTTGGG - Intergenic
1067750878 10:48970143-48970165 TTCGAGAACCTGGCTGCCTGGGG + Exonic
1070130121 10:73649996-73650018 TTTGTGTGCCTGGCTGGCAGTGG - Intronic
1072039128 10:91590832-91590854 TTCTTGGGCCTGGAAGGCTGGGG + Intergenic
1072628774 10:97131531-97131553 CTCTAGGGCCTGGCTGGTAGCGG - Intronic
1072656674 10:97334677-97334699 CTCGAGTGCCTGGCGGGCTCCGG - Exonic
1073453025 10:103620492-103620514 TCCAAGGGCCTGGCTGGCTGAGG + Intronic
1076485470 10:130812956-130812978 TGGGAGGGCCTGGCTGTGTGAGG - Intergenic
1076545945 10:131245861-131245883 TGCAAGGGCCTGGGTGGCAGAGG + Intronic
1077303264 11:1856742-1856764 CCCAAGGGCCTGGCTGCCTGGGG - Intronic
1077672058 11:4166279-4166301 GAGGAGGGCCTGGATGGCTGAGG + Intergenic
1078005256 11:7527653-7527675 TGGGGGGGCCTGGCTTGCTGAGG + Intronic
1081640680 11:44751343-44751365 CTCCAGGGCCAGGCTGCCTGGGG + Intronic
1082163054 11:48905247-48905269 TTTTAGAGCCTGGCTAGCTGAGG - Intergenic
1082238356 11:49847479-49847501 TTTTAGAGCCTGGCTAGCTGAGG + Intergenic
1082611640 11:55305994-55306016 TTTTAGAGCCTGGCTAGCTGAGG + Intergenic
1082658272 11:55877667-55877689 TTTTAGAGCCTGGCTAGCTGAGG - Intergenic
1084184943 11:67466582-67466604 GCCAGGGGCCTGGCTGGCTGGGG + Intronic
1084534043 11:69746366-69746388 AGTGAGGGCCAGGCTGGCTGGGG + Intergenic
1084702673 11:70797547-70797569 TTGTAGGGCCTGGCTGGCCCTGG + Intronic
1085390018 11:76177531-76177553 TCCGAGGGGCTGGGGGGCTGTGG - Intergenic
1086690431 11:89784310-89784332 TTTTAGAGCCTGGCTAGCTGAGG + Intergenic
1086698225 11:89868670-89868692 TTTTAGAGCCTGGCTAGCTGAGG - Intergenic
1086707939 11:89975818-89975840 TTTTAGAGCCTGGCTAGCTGAGG + Intergenic
1086715368 11:90055333-90055355 TTTTAGAGCCTGGCTAGCTGAGG - Intergenic
1086898301 11:92338558-92338580 CTCGAAGGCCTGGGAGGCTGTGG + Intergenic
1087837230 11:102887236-102887258 TCCCAGGGCCTGGCTGGCACTGG + Intergenic
1089621096 11:119722661-119722683 CTCGGGAGCCTGGCTGCCTGTGG - Intronic
1089685588 11:120144683-120144705 CCTGAGGGACTGGCTGGCTGTGG + Intronic
1090444635 11:126753310-126753332 CTGGAAGGCCTGGCTGGCTGTGG - Intronic
1091656732 12:2351586-2351608 GTCCAGGGCGTGGCTGGCAGTGG + Intronic
1091802598 12:3334025-3334047 GCCGAGGGCCTGGCTGGCCGTGG - Intergenic
1092131299 12:6114960-6114982 TTCCTGGCCCTGGATGGCTGAGG + Intronic
1092318095 12:7440421-7440443 TTCAAGGGCCGGGCTGGGCGCGG - Intronic
1092668219 12:10830936-10830958 TTCCTGGGCCTGGCCGGGTGCGG - Intronic
1093778458 12:23105403-23105425 TGTGAGAGCCTGGCTGACTGTGG + Intergenic
1096180590 12:49548600-49548622 TCGGAGGGCCTGGCTGGCGTGGG - Intronic
1096513220 12:52143361-52143383 TTTCTGGGACTGGCTGGCTGGGG - Intergenic
1097194356 12:57235511-57235533 GTGGATGGGCTGGCTGGCTGTGG + Exonic
1100054913 12:90497436-90497458 TTCTAGGGGCTGTCTGACTGAGG - Intergenic
1103447254 12:121002233-121002255 CCTGGGGGCCTGGCTGGCTGAGG + Exonic
1103783006 12:123412065-123412087 TAAGATGGCCTGGGTGGCTGTGG - Exonic
1103960019 12:124603608-124603630 GTTGAGTGCCTGGCTGGCTGTGG - Intergenic
1104618321 12:130289727-130289749 TCTGAATGCCTGGCTGGCTGTGG - Intergenic
1106383447 13:29262635-29262657 TCCCAGGGCCTGACTGACTGAGG - Intronic
1106566385 13:30888218-30888240 ATCGAGGACCTGGGTGGCTGAGG - Intergenic
1108644032 13:52408497-52408519 TTCCTGGGCTGGGCTGGCTGAGG - Intergenic
1112588595 13:100742882-100742904 TTCGAGGGCCTGAATGATTGGGG - Intergenic
1117163446 14:53011337-53011359 AGCGAGGGAGTGGCTGGCTGGGG - Intergenic
1118709224 14:68506109-68506131 TTCTAGGCCCAGGCTGCCTGGGG - Intronic
1119027601 14:71166414-71166436 TCAGAGGGCCTGGCAGGCTGGGG - Intergenic
1119666881 14:76491341-76491363 TTGCAGGGCGTGGCTGGTTGCGG - Intronic
1119998642 14:79279269-79279291 GCCGAGGGACTGGCTGGCTCCGG - Intronic
1120865002 14:89288220-89288242 TTGGTGGGCCTGGTTGGTTGTGG - Intronic
1121245344 14:92457933-92457955 GGCGTGGGCCTGGCAGGCTGGGG + Intronic
1121439010 14:93937113-93937135 TGCCAGGGCCTTGCTGGGTGAGG - Intronic
1121676369 14:95756493-95756515 TTAGAGTTCCTGGCTGGGTGCGG + Intergenic
1122062301 14:99144115-99144137 CTGGAGAGCCTGGCTGGCTCTGG - Intergenic
1122336376 14:100990491-100990513 TCCGAGGACTTGGGTGGCTGAGG + Intergenic
1122857024 14:104564898-104564920 TTCTCGGGTCTGGCGGGCTGGGG - Intronic
1122858700 14:104572438-104572460 ATTGAGGGACAGGCTGGCTGGGG - Intronic
1122878878 14:104681086-104681108 TTCCAGGGCCTGGCTCGGGGAGG - Intergenic
1124109231 15:26772196-26772218 CTCGGGGGCCTGGCTGGCGTCGG - Intronic
1126933090 15:53676561-53676583 TCTGAGGGCCTTGCTGGCTGTGG - Intronic
1128525961 15:68412460-68412482 GTTGGGTGCCTGGCTGGCTGTGG - Intronic
1129263512 15:74382081-74382103 GTGCTGGGCCTGGCTGGCTGAGG - Intergenic
1130942966 15:88526468-88526490 TAGGAGGGCCTTGCTGACTGTGG + Intronic
1130979615 15:88803587-88803609 TGCGGAGTCCTGGCTGGCTGAGG - Exonic
1132176931 15:99723475-99723497 TTTGTGGGCCTTGCTGACTGAGG + Intronic
1132675175 16:1118416-1118438 TGGGAAGGCGTGGCTGGCTGGGG + Intergenic
1132699157 16:1214943-1214965 GTGGAGGGTCGGGCTGGCTGAGG - Intronic
1132975584 16:2709694-2709716 CCCCAGGGCCTGGCTGTCTGAGG + Intergenic
1133234736 16:4382568-4382590 CTCGCGGGCCTGGGTGACTGGGG - Exonic
1134666793 16:16024644-16024666 TTCCAAGTCCTGGCTGGATGTGG - Intronic
1137693399 16:50445657-50445679 TCCCAGGACGTGGCTGGCTGAGG - Intergenic
1137767758 16:50991207-50991229 GCCGAGCGCCAGGCTGGCTGAGG + Intergenic
1138328012 16:56191503-56191525 CTCGAGCTCCCGGCTGGCTGCGG + Intronic
1139956893 16:70697487-70697509 TGCGAGGGCCTGGCTGGGAGTGG + Intronic
1140315798 16:73895492-73895514 TTTGGGGGACTGGATGGCTGAGG - Intergenic
1140727842 16:77830032-77830054 CTCGAGGGGCTGGCTGGAGGTGG - Intronic
1141169994 16:81685060-81685082 TTCGTGGGCCTGCCAGTCTGGGG + Intronic
1141461557 16:84181170-84181192 TTCCAGGGCCCGCCGGGCTGTGG - Exonic
1203138404 16_KI270728v1_random:1744809-1744831 TCCGCGGGCAAGGCTGGCTGTGG + Intergenic
1142471404 17:165116-165138 TTTGGGGGCCTGGCTGGCTTGGG + Intronic
1142968930 17:3598237-3598259 TACGAGGGCCTCCCTGGCAGTGG - Intergenic
1143782975 17:9239183-9239205 TTGGAGGGCCAGGCTGTGTGTGG + Intronic
1144958522 17:19031941-19031963 TTCCTGGGCTTGGCTGGCTGTGG - Intronic
1144976638 17:19142583-19142605 TTCCTGGGCTTGGCTGGCTGTGG + Intronic
1145973971 17:28973688-28973710 TTTGAGGGCCAGGCTGACAGAGG + Intronic
1146003236 17:29144195-29144217 TGGGGTGGCCTGGCTGGCTGTGG - Intronic
1147189443 17:38730268-38730290 TTCCGGGGCCTGGCGGGCCGGGG + Exonic
1148067658 17:44884311-44884333 TTGGAAGTCCTGGCTGGGTGTGG - Intronic
1151174191 17:72273769-72273791 TCAGAGGGCCAGGCTGGGTGTGG - Intergenic
1151596740 17:75082562-75082584 TTCCTGGGCCAGGCTGGGTGTGG + Intergenic
1152263477 17:79279672-79279694 TGGGAGTGCCTTGCTGGCTGTGG - Intronic
1153452131 18:5241124-5241146 TTTGAGGTCCTGGCAGGCTCTGG + Intergenic
1154008447 18:10555652-10555674 ATGCAGGGCCTGGCTGGCTGGGG + Intergenic
1154173759 18:12068362-12068384 CTCGCGGGCCTGGCTGTCGGAGG + Intergenic
1155908940 18:31486759-31486781 ATGGGGGGCCTGGCTCGCTGTGG - Intergenic
1157683087 18:49622160-49622182 CTAGAGGACCTGGCAGGCTGGGG + Intergenic
1160431123 18:78813312-78813334 GGAGAAGGCCTGGCTGGCTGTGG + Intergenic
1162780008 19:13002091-13002113 GCCCAGGGCCTGCCTGGCTGTGG - Intronic
1163631413 19:18419683-18419705 CTCGCGGGCCTGGCTGTCGGAGG - Exonic
1163669526 19:18619276-18619298 TGTGAGGTCCTGGCTGGGTGAGG - Intronic
1164696945 19:30252339-30252361 TTGTTGGCCCTGGCTGGCTGTGG + Intronic
1164878145 19:31707476-31707498 TTCCAGGGGCTGGCCGTCTGTGG - Intergenic
1166502048 19:43348908-43348930 TTCATAGGCCTGGCTGGGTGTGG - Intergenic
1166508065 19:43384544-43384566 TTCATAGGCCTGGCTGGGTGTGG + Intergenic
1167003032 19:46756964-46756986 TTCGGGGGTCTGTCTGGATGTGG + Exonic
1167455384 19:49594948-49594970 TTCGAGCGCCTGGCAGGGGGCGG + Exonic
1167456984 19:49601577-49601599 GGCGAGGGCAGGGCTGGCTGTGG - Exonic
1168120577 19:54250674-54250696 TTAGGGGTCCAGGCTGGCTGGGG + Exonic
1168683774 19:58335730-58335752 GACGAGGGCCTGGGTGCCTGGGG + Intronic
927962615 2:27250345-27250367 TCCTAGAGCCCGGCTGGCTGGGG - Intergenic
930781007 2:55224817-55224839 TCCGAGAACCGGGCTGGCTGGGG - Intronic
930849208 2:55939982-55940004 TTAGAGGCCATGGCTGGCTCAGG + Intergenic
932077529 2:68679292-68679314 TTGGAGTGCCTGGCTGTGTGAGG + Intergenic
932567535 2:72918897-72918919 GTGGAGGGCCTGGCTGTCTTGGG + Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933587088 2:84190973-84190995 TGCAAGGGCATGGCTGGTTGGGG - Intergenic
933791446 2:85887054-85887076 TTCCAGGTCCTGGAGGGCTGAGG - Intronic
933975285 2:87504556-87504578 TTTGAGGGAGTGGGTGGCTGTGG - Intergenic
934242909 2:90287993-90288015 TTGGATTGGCTGGCTGGCTGGGG - Intergenic
936049861 2:109214496-109214518 CGCCAGGGCCTGGCTGGCTTGGG - Intronic
936143292 2:109959820-109959842 CCCGAGGGCCTGACTGGCTGAGG + Intergenic
936179980 2:110257786-110257808 CCCGAGGGCCTGACTGGCTGAGG + Intergenic
936201395 2:110411647-110411669 CCCGAGGGCCTGACTGGCTGAGG - Intronic
936318541 2:111446257-111446279 TTTGAGGGAGTGGGTGGCTGTGG + Intergenic
942302941 2:174579844-174579866 TTGGAGGGCTTGGAGGGCTGAGG + Intronic
944389668 2:199204610-199204632 GCAGAGGTCCTGGCTGGCTGTGG - Intergenic
946196430 2:218035161-218035183 CAGGAGAGCCTGGCTGGCTGGGG - Intronic
946200712 2:218069325-218069347 CAGGAGAGCCTGGCTGGCTGGGG - Exonic
946875565 2:224126220-224126242 GCCGAGGGCGTGGCTGGCTGAGG + Intergenic
947165100 2:227253754-227253776 CTGGAGGTTCTGGCTGGCTGAGG - Intronic
947668752 2:231923777-231923799 TTCTTGGGCCTGGATGTCTGTGG - Intronic
1170882012 20:20305086-20305108 CGCGAGGGCCGGGCTGTCTGAGG - Intronic
1171238928 20:23549543-23549565 TGCAAGGTCCTGGCTGGATGGGG - Intergenic
1172393662 20:34583754-34583776 TTCCATGGCCTGGCAGGCTCCGG - Intronic
1172647444 20:36479777-36479799 GTCGAGGGGCTGGATGGTTGGGG + Intronic
1172702989 20:36863861-36863883 TTCGAGGGTCAGGCTGGCGCGGG + Intergenic
1172744805 20:37198461-37198483 TGAGAGGGCCTGGCTGGCCTGGG - Exonic
1173868835 20:46329499-46329521 TTGGAGGGAAGGGCTGGCTGGGG + Intergenic
1174203593 20:48824087-48824109 TTCGAGGCCCTGGCTATGTGGGG - Intronic
1174328196 20:49796445-49796467 TTTGAGGTCTTGGCTGGGTGTGG - Intergenic
1175284330 20:57827820-57827842 TTTGAGGCCCTGACAGGCTGGGG + Intergenic
1175658644 20:60793365-60793387 GCTGAGGGTCTGGCTGGCTGGGG + Intergenic
1176223804 20:63982777-63982799 TTTAAGGGCCTGGTTGGATGTGG + Intronic
1178006952 21:28233006-28233028 CTGGAGGGCTTGGCTGGCAGTGG - Intergenic
1179098204 21:38334418-38334440 TTCAAGCCCCTGGCTGCCTGTGG - Intergenic
1179120524 21:38540976-38540998 TTTGAGCGCTTGGGTGGCTGGGG + Intronic
1179595683 21:42441571-42441593 CTCGGGGGCCTGGTTGGATGGGG + Intronic
1179596033 21:42443812-42443834 TTCCAGGGCCTGGGCGGCAGGGG - Intronic
1179976692 21:44872611-44872633 CTCCAGGGCCTGGTGGGCTGCGG - Intronic
1180183072 21:46126604-46126626 CTCGAGGGCCGGGCTGGGGGAGG + Intronic
1180676594 22:17590751-17590773 TTCGAATCCCTGGATGGCTGAGG + Exonic
1181028876 22:20140579-20140601 TTGGGAGGCCAGGCTGGCTGAGG + Intronic
1181310772 22:21943671-21943693 TGGGAGGGCCTGGAGGGCTGAGG - Intronic
1182437714 22:30341282-30341304 TTAGAGGGCCTGGCTTGAAGGGG + Intronic
1183373372 22:37448296-37448318 TGAGAGGGCCTGGCTTTCTGTGG - Intergenic
1183456889 22:37927716-37927738 CTGCAGGGCTTGGCTGGCTGGGG - Exonic
1183608164 22:38879083-38879105 TTTGAGGTCCTGGAGGGCTGGGG + Intergenic
1184710174 22:46245097-46245119 TCCGAGAACCGGGCTGGCTGGGG + Exonic
1185056477 22:48581303-48581325 GCCGAGGGCCAGGCTGGCAGTGG + Intronic
1185338719 22:50282331-50282353 TTCGTGGGCTCGGCTGGCAGGGG + Intronic
950153945 3:10708342-10708364 TCCCAGGGCCAGGCTGGCTGTGG - Intergenic
950187428 3:10953719-10953741 TACGAGTGTCTTGCTGGCTGTGG + Intergenic
950390722 3:12694438-12694460 TCACAGGGCCTGGCTGGCTCCGG + Intergenic
950431647 3:12954378-12954400 CCCGAGGGCCTTGGTGGCTGTGG + Intronic
950667384 3:14505722-14505744 AGCGGAGGCCTGGCTGGCTGAGG - Exonic
951779318 3:26345777-26345799 TTGCAGGGCCTGGCTGGTAGGGG - Intergenic
953911719 3:46896580-46896602 ATTGTGGGCCTGGCTGGGTGGGG + Intronic
953976435 3:47385050-47385072 TACGTGGGTCTGGCTGGGTGTGG - Intronic
954629409 3:52039979-52040001 TTCCCGGGCCCGGCTGGGTGGGG + Intergenic
954684108 3:52361336-52361358 TTCAAGGGCCTGGCCAGGTGAGG + Exonic
961505651 3:127369147-127369169 TGCGAGGCGCTGGCTGGGTGTGG + Intergenic
961564870 3:127756259-127756281 ATCTAGGGCCTTGCTGACTGGGG + Intronic
962853763 3:139326804-139326826 GTGTAGGGCCTGGCTGGCAGTGG + Intronic
964610510 3:158610243-158610265 ATAGAGGGGTTGGCTGGCTGTGG + Intergenic
965812574 3:172606984-172607006 TTAGAAGGCCTGGCTGGGCGTGG + Intergenic
968743120 4:2341194-2341216 TTTTAGGTCCTGGCTGTCTGGGG + Intronic
969263173 4:6046470-6046492 TGTGAGGGCCTGGCAGGCTAGGG + Intronic
969305897 4:6326167-6326189 TGGGAGGGGTTGGCTGGCTGAGG + Intronic
969489286 4:7490101-7490123 CCCAGGGGCCTGGCTGGCTGGGG + Intronic
972741395 4:41890108-41890130 ATCCAGAGCCTGGCTTGCTGGGG + Intergenic
978043673 4:104100037-104100059 TTTGGGGGACTGGCTGGGTGTGG + Intergenic
979251089 4:118567309-118567331 TACCAGGGGCTGGGTGGCTGGGG - Intergenic
981808164 4:148740931-148740953 TGCTGGGGCCTGGCTGGGTGAGG + Intergenic
982767375 4:159364510-159364532 TTCCAGGGCTTTGCTGGCTCAGG - Intergenic
986676949 5:10194108-10194130 CTCAAGGGCCTGGCTGCGTGTGG - Intergenic
992062160 5:73063831-73063853 GTTGTGGGCCTGGCTGGTTGAGG - Exonic
993493651 5:88583437-88583459 TTTGAGGGCCTGACTGCATGTGG - Intergenic
997425764 5:133801638-133801660 ATCAAGGCCCTGGCTGGCAGTGG - Intergenic
998152319 5:139764510-139764532 GCCGAGCGCCTGCCTGGCTGCGG + Intergenic
1001071695 5:168590911-168590933 TTCAAGGTCCTGGGTGGCTGGGG - Intergenic
1002440474 5:179261969-179261991 TCCCAGGGCCTGGCTGCCTGTGG + Intronic
1003138905 6:3455876-3455898 TTGGAGGGACTGGGCGGCTGCGG + Intronic
1003544961 6:7051672-7051694 GTCGAGGGCCTGGCTGGTGTGGG + Intergenic
1005885892 6:30097470-30097492 TTTGAGGCCCTGGAAGGCTGAGG + Intergenic
1006364466 6:33607321-33607343 TTCAAAGGCCTGTCTGGCTCAGG + Intergenic
1006580925 6:35077544-35077566 TGCGAGGGCCTCCATGGCTGAGG + Intronic
1006922935 6:37638275-37638297 TTCGAGGCCCGGGCTACCTGGGG - Exonic
1007250837 6:40493802-40493824 TTCTAGAGCCTGGCTTGATGGGG - Intronic
1007622362 6:43222905-43222927 GAGGAGGGCCTGGCTGGCAGGGG - Intronic
1007688125 6:43679598-43679620 TTAGAAAGCCTGGCTGACTGAGG + Intronic
1008383356 6:50858931-50858953 TACTAGTGCCTGGCTGGGTGCGG + Intergenic
1012630091 6:101455136-101455158 TTAGTGGGCATGGCAGGCTGAGG + Intronic
1013031227 6:106335235-106335257 TTGGCTGGCCTTGCTGGCTGGGG - Intergenic
1016823575 6:148367833-148367855 CTCGAGTGCCTGGGTGGCAGCGG + Intronic
1017764037 6:157592721-157592743 AGGGAGGGCCTGGCTGGGTGGGG + Intronic
1018042062 6:159933626-159933648 TTCCAGGGCTTGTCTAGCTGTGG - Intergenic
1019311963 7:367237-367259 TTGGAGAACCTGGCTGGGTGAGG - Intergenic
1019670622 7:2276230-2276252 TTCTGGGGCCTGGCAGCCTGGGG - Intronic
1020123564 7:5519609-5519631 CTGGAGCGCCTGGCTGACTGTGG + Intergenic
1023881491 7:44323999-44324021 GTGGGGGGCCAGGCTGGCTGGGG - Intronic
1025994400 7:66518868-66518890 TTGGAGGGCCAGGCTGGAAGTGG + Intergenic
1026033598 7:66815795-66815817 TTGGAGGGCCAGGCTGGAAGTGG - Intergenic
1026572649 7:71545032-71545054 TTCTAGTGGCTGGCTGGCTAGGG + Intronic
1026881484 7:73909265-73909287 TTCCAGGGCAGGGCTGGCTCAGG - Intergenic
1026986011 7:74555557-74555579 TTGGAGGGCCAGGCTGGAAGTGG + Intronic
1027111378 7:75442539-75442561 TGCGCTGGCCTGGCTGGCCGTGG - Intronic
1027283619 7:76627098-76627120 TGCGCTGGCCTGGCTGGCCGTGG - Exonic
1027399613 7:77794016-77794038 TTTATGGGCCTTGCTGGCTGGGG - Exonic
1030746441 7:113172114-113172136 TTCCTGGCCCTGGCTGGGTGTGG - Intergenic
1031468580 7:122143719-122143741 TTAGAGGGGACGGCTGGCTGAGG - Intronic
1034415487 7:150962295-150962317 TTCGAGGGCCTGGCTGGCTGTGG - Intronic
1037811144 8:22087643-22087665 TTCGATGGTCTCGCTGGCTTAGG - Intergenic
1039858359 8:41435530-41435552 TTCCAGGGCCAGGCCGGCTCAGG + Intergenic
1047212973 8:122854521-122854543 GTCGAGGGACTGGAAGGCTGGGG - Intronic
1047304315 8:123640682-123640704 TTCGTTGGCCTCACTGGCTGGGG - Intergenic
1047732028 8:127736047-127736069 TGCGAGGGTCTGGACGGCTGAGG + Exonic
1048469556 8:134695210-134695232 TGCGAGGGCCTTCCTGGCCGGGG - Intronic
1048995673 8:139792421-139792443 TGCGTGGGCCTGGCTGCGTGTGG + Intronic
1049444408 8:142623454-142623476 TGGGAGGGCATGGCAGGCTGAGG + Intergenic
1049588969 8:143446956-143446978 TCCCAGGGCCAGGCTGGCTTGGG - Intronic
1049759600 8:144326130-144326152 TTCGAGGGGCGGGCTGGTGGGGG - Intronic
1050514669 9:6430466-6430488 TTTGGGGGCCTTACTGGCTGAGG + Intronic
1051629201 9:19127224-19127246 TTCCAGGTCCTGGCTGGGTAGGG - Intronic
1053022076 9:34701750-34701772 CTCGGGGGCCTGGGTGGCAGGGG - Intergenic
1053365942 9:37522673-37522695 TGGGAGGGCCTGGGTGACTGTGG + Intronic
1053393268 9:37751412-37751434 CTCGAGGGCTCTGCTGGCTGTGG + Intronic
1056662464 9:88554493-88554515 TTAAAGGGCCTGTCTGGGTGCGG - Intronic
1060498491 9:124134992-124135014 ATCGAGAACCTGGCTGGGTGTGG - Intergenic
1060933502 9:127503296-127503318 CAGGAGGGCCTGGCTGGGTGAGG + Exonic
1061366892 9:130176905-130176927 CTCTTGGGCCTGGCTGGCTTGGG - Intronic
1061557845 9:131382933-131382955 ATGGGGGGCCTGGCTGGGTGCGG - Intergenic
1062450483 9:136613809-136613831 TGGGAGGGGCTGGCCGGCTGTGG + Intergenic
1062697186 9:137881392-137881414 CTCGAGAGCCTGGCTTCCTGGGG + Intronic
1187399713 X:18948653-18948675 TTTGAGGGCCAGGCTGTTTGGGG - Intronic
1189377058 X:40474523-40474545 TCCCTGGGCCTGCCTGGCTGGGG - Intergenic
1189726221 X:43970186-43970208 CTCCAGGGCCTGGGTTGCTGTGG - Intronic
1190971752 X:55356694-55356716 CTAGAGGGCTGGGCTGGCTGGGG - Intergenic
1194210747 X:91066296-91066318 TTGGAGGGGCTGGCAGGCAGGGG - Intergenic
1196750536 X:119113158-119113180 TTCTAGGGCCTGGCGGGCGTTGG + Intronic
1197746101 X:129932788-129932810 TCCGAGGGCCAGGCTGGGCGAGG - Intergenic
1198959075 X:142164834-142164856 TTCCAGGGCCTTAGTGGCTGGGG - Intergenic
1200227051 X:154423828-154423850 TTCCAGGGCCTGGGAGGATGGGG + Intergenic