ID: 1034416419

View in Genome Browser
Species Human (GRCh38)
Location 7:150966771-150966793
Sequence CTGTTGGAGTCGGGGCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034416410_1034416419 7 Left 1034416410 7:150966741-150966763 CCAGGAATTGACCAAGAAGGCAC 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1034416419 7:150966771-150966793 CTGTTGGAGTCGGGGCAAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 149
1034416411_1034416419 -4 Left 1034416411 7:150966752-150966774 CCAAGAAGGCACAAGAACCCTGT 0: 1
1: 0
2: 2
3: 12
4: 183
Right 1034416419 7:150966771-150966793 CTGTTGGAGTCGGGGCAAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034416419 Original CRISPR CTGTTGGAGTCGGGGCAAAA GGG Intronic
906686205 1:47765053-47765075 CTGTTGAAGTCCTGGCTAAATGG - Exonic
907829763 1:58053553-58053575 GTGTTGGAGTTGGGGCCTAATGG - Intronic
907906968 1:58791296-58791318 CTGTTGGAGGTGGGGCCAAATGG - Intergenic
908469974 1:64434211-64434233 GTGTTGGAGTTGGGTCCAAATGG + Intergenic
910629863 1:89343522-89343544 CTGTTGGAAATGGGCCAAAAAGG - Intergenic
913421626 1:118676101-118676123 CTGTTGGAGTTGGGGCCTAGGGG - Intergenic
915722618 1:157995450-157995472 CTGTTGGTGTCGGGGAGGAAGGG + Intronic
916767189 1:167872736-167872758 CTGGTGGAATCAGTGCAAAAGGG + Intronic
920110821 1:203585988-203586010 TTGTTGAAGTCGGGGGAGAATGG + Intergenic
921129193 1:212205178-212205200 GTGTTGGAGGCGGGGCATAATGG + Intergenic
922643118 1:227256315-227256337 CTGTTGGGGTGGGGGCCAAGAGG + Intronic
922876799 1:228946107-228946129 ATGTTGGAGGCGGGGCCTAATGG - Intergenic
923187236 1:231586124-231586146 TTGTTGGAGTCAGGACAAAATGG + Intronic
1070826365 10:79392510-79392532 CTGATGGTGCAGGGGCAAAACGG - Intronic
1071948965 10:90681167-90681189 CTGTTGGATTCAAGGCAGAAAGG + Intergenic
1072567081 10:96625672-96625694 TTGTTGGAGGTGTGGCAAAAGGG - Intronic
1073457381 10:103645819-103645841 CTCTGGGAGTTGGGGCAAACAGG - Intronic
1075078876 10:119369644-119369666 CTTTAAGAGCCGGGGCAAAAAGG - Intronic
1075239344 10:120764045-120764067 CTTTTGGAGTGGGGGAAACAGGG + Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079550111 11:21685111-21685133 CTGCTGGATTCAGGTCAAAAGGG - Intergenic
1079921361 11:26437338-26437360 CTGTTGGAGTGGGTTCACAAGGG + Intronic
1080271046 11:30451100-30451122 CTGTAGGGGTCTGGGCAAATCGG + Intronic
1082777117 11:57254369-57254391 GTGTTGGAGTTGGGGCCCAATGG - Intergenic
1085322181 11:75582162-75582184 CTCTTGAAGTGGGGGGAAAAGGG - Intergenic
1087901993 11:103651349-103651371 CTGTTGGGGTGGGGGCACAATGG + Intergenic
1087964203 11:104392396-104392418 ATGTTGGAGGCGGGGCCAAATGG + Intergenic
1088089503 11:106021878-106021900 CGGTGGGAGTCGGGGCAACCTGG + Exonic
1088445925 11:109928454-109928476 GTGTTGGAGTTGGGGCTTAATGG + Intergenic
1088667987 11:112113669-112113691 TTTTTGGAGTTGGGGGAAAAGGG - Intronic
1088817574 11:113432182-113432204 CTGATGGAGTGGGGTGAAAAGGG + Intronic
1091032413 11:132202654-132202676 CTCTTGGCTTCGGGGCATAATGG - Intronic
1095909255 12:47409180-47409202 CTGTTGGTGTCGGGGTGGAAGGG + Intergenic
1099963397 12:89418561-89418583 CTGTTGGAGATGGGGCTTAAGGG + Intergenic
1102824022 12:115931715-115931737 CTGTTGGTGGCTGGGCACAATGG + Intergenic
1104396485 12:128438217-128438239 GTGTTGGAGTTGGGGCCTAATGG + Intronic
1108966020 13:56302920-56302942 CTATTGGAGTTGGGGAAAACTGG + Intergenic
1109097329 13:58134545-58134567 CTGTTGGTGTGGGCTCAAAAAGG + Intergenic
1112553529 13:100445244-100445266 GTGTTGGAGGTGGGGCATAATGG - Intronic
1113224340 13:108142955-108142977 CTGTTTGAGTTGGGACATAAAGG + Intergenic
1113650251 13:112029309-112029331 TTGTTGAAGTCGGGGCCAACCGG + Intergenic
1117761168 14:59030513-59030535 ATGTTGGAGGTGGGGCACAATGG + Intergenic
1118328243 14:64795952-64795974 CTGTTGGATTTGGGGCAGGAAGG + Intronic
1120933485 14:89871768-89871790 CTGATGGAGTCAGGGGGAAAAGG - Intronic
1125465335 15:39945331-39945353 CTGTTACTGTCGGGGCAAACTGG - Intronic
1127078157 15:55348450-55348472 CTGTTGGAGGTGGGGCCTAATGG + Intronic
1130696290 15:86135009-86135031 ATGTTGGAGTTGGGGCCTAATGG + Intergenic
1132469509 16:94148-94170 CTGTGGGAGTCGGGGCACATGGG - Intronic
1134008921 16:10836792-10836814 ATGTTGGAGGTGGGGCCAAATGG + Intergenic
1136636170 16:31524612-31524634 AGGTTGGAGTCAGGGCAAAAAGG - Intergenic
1137419949 16:48324460-48324482 CTGATGGAGTAGGAGCAAAATGG - Intronic
1138525459 16:57603490-57603512 CTATTGGAGATGTGGCAAAAAGG + Intergenic
1139320076 16:66107168-66107190 CTGCTGGAGGCAGGGCGAAAAGG - Intergenic
1141049334 16:80746399-80746421 CTACTGGAGTCGGTGCCAAATGG - Intronic
1142068628 16:88076874-88076896 CTGTTGGTGTCGGAGCACGAGGG + Exonic
1143575052 17:7787361-7787383 TTGTTGGAGTGGGTGGAAAAGGG - Intronic
1143927596 17:10386064-10386086 ATGTTGCAGTTGGGACAAAAGGG - Intergenic
1145771194 17:27494540-27494562 CTGTTGAAGTCGAGGCAGAGGGG - Intronic
1149286931 17:55175648-55175670 CTTTTAGAGTCGGGGGACAAAGG + Intergenic
1150056715 17:62023520-62023542 CTGCTGGAGTTGGCTCAAAAAGG + Intronic
1150259298 17:63774998-63775020 CTATAGGAGTGGGGGCAAGAGGG - Intronic
1151352005 17:73537379-73537401 AGGCTGGAGTCGGGGCAGAAGGG - Intronic
1151683840 17:75635565-75635587 CAGTTGGAGCCAGGGCAAAAAGG + Intronic
1155249826 18:23944018-23944040 CTGTTGGAGTCGCTGAAAATAGG + Intronic
1155267533 18:24107959-24107981 CTGTTAGAGTCTGAGCAACATGG - Intronic
1157749385 18:50164739-50164761 CTGTTGGAGGGGTGGCAAGAGGG - Intronic
1160333745 18:78018423-78018445 CTGAGGGAGTGGGTGCAAAACGG - Intergenic
1161575257 19:5051378-5051400 CTGATGGGTTGGGGGCAAAAGGG - Intronic
1164265354 19:23610763-23610785 CTGTTAGTGTGGGAGCAAAAGGG + Intronic
1166697651 19:44862725-44862747 CTGTTGGAGGCTGGGCACAGTGG + Intronic
926851957 2:17208323-17208345 TTTTTGGAGTCGGGGGAAGAGGG + Intergenic
927758359 2:25727102-25727124 CTGTTGGGGTCGGGGGCAGAGGG - Intergenic
929134651 2:38611947-38611969 CTGTAGGAGTCTTGGCAAATTGG + Intergenic
929514057 2:42590223-42590245 GTGTTGGAGGTGGGGCATAATGG + Intronic
930053612 2:47235715-47235737 CTGCTTGAGTAGGGACAAAAGGG + Intergenic
931603369 2:64026794-64026816 CTGGTGGGGTCGGGGGAAGAAGG - Intergenic
935594112 2:104866548-104866570 CTGGCTGAGTTGGGGCAAAATGG + Intergenic
936277785 2:111115684-111115706 CTGTTGCAGTCTAGGAAAAATGG + Intronic
936694671 2:114931551-114931573 ATGTTGGAGGTGGGGCCAAATGG - Intronic
937841373 2:126527832-126527854 GTGTTGGAGACGGGGCTTAATGG - Intergenic
938938909 2:136152060-136152082 TTACTGGAGTCGTGGCAAAATGG - Intergenic
943281209 2:185935570-185935592 CTGTTGGAGATGTGGAAAAAGGG - Intergenic
943769121 2:191695763-191695785 CTGTTGGAGACGGGGCCTAGGGG - Intronic
947350674 2:229241420-229241442 CTGTTGGACTGAGGGCAAAATGG - Intronic
1171308093 20:24123225-24123247 CTGCTGGAGTGTAGGCAAAAAGG + Intergenic
1173754603 20:45504518-45504540 CTGTTGCAGTGGGGGCAGACTGG - Intergenic
1173929366 20:46806021-46806043 CTGTTGGGGTCTGGTCAAAGCGG - Intergenic
1175174709 20:57104241-57104263 CTGTTGGAATGGGAGCAACAAGG - Intergenic
1176015065 20:62926704-62926726 CTCTTGGAGTCGGGGAAATAAGG - Intronic
1177368286 21:20167844-20167866 ATGTTGGAGGAGGGGCCAAATGG - Intergenic
1177445919 21:21196292-21196314 CTGATTGAGGCTGGGCAAAAAGG + Intronic
1178241474 21:30906466-30906488 TTATTGGAGTCTGTGCAAAAAGG - Intergenic
1185034486 22:48464838-48464860 CTGATTGAGTTGGAGCAAAAGGG + Intergenic
949705735 3:6814379-6814401 ATGTTGGAGTTGGGGCTTAATGG - Intronic
950297102 3:11841725-11841747 CTGCTGGAGTTGGGGGGAAAAGG - Intronic
951195891 3:19823077-19823099 CTGTGGCAGTTGGGGCACAAGGG + Intergenic
953215872 3:40917543-40917565 GTGTTGGTGTTGGGGCTAAAGGG - Intergenic
958430238 3:94031498-94031520 CTGTTGGAGTTGTACCAAAAGGG + Intronic
960664368 3:120095106-120095128 GCGCTGGAGTTGGGGCAAAAGGG + Intergenic
963538475 3:146557801-146557823 ATGTTGGAGATGGGGCCAAAAGG + Intergenic
967211339 3:187172912-187172934 TTGGTGGAGTGGGGGGAAAAGGG - Intronic
970809255 4:20072221-20072243 ATGTTCGAGTTGGGGCCAAATGG - Intergenic
971250650 4:24970770-24970792 ATGTGGGAGTCTGGGCAACATGG - Intronic
979194663 4:117905938-117905960 CTTTTAGATTCGGGGCAAGAAGG + Intergenic
979306807 4:119155221-119155243 GTGTTGGAGTTGGGGCCTAATGG - Intronic
980317098 4:131216558-131216580 CTGTTGGGGTTGGGGGACAAGGG - Intergenic
981154438 4:141417277-141417299 ATGTTGGAGGCGGGGCCTAATGG + Intergenic
983526248 4:168763019-168763041 CTGTTGGGGTAGGGGGCAAAGGG + Intronic
984558731 4:181243016-181243038 CTGTTGGGGGCGGGGGACAAAGG + Intergenic
986295892 5:6438197-6438219 GTGTTGGAGTCAGTGGAAAATGG + Intergenic
986847342 5:11770690-11770712 CTGTTGGATTTGGGGCGCAAAGG + Intronic
990130354 5:52574610-52574632 GTGTTGGAGTTGGGGCCTAAAGG + Intergenic
992765770 5:79998188-79998210 CTGTTGGAGGAGGGGCCTAATGG + Intronic
993087843 5:83385804-83385826 CTGTTGGTGGGGGTGCAAAATGG + Intergenic
993653857 5:90554761-90554783 GTGTTGGAGTTGGGGCCTAATGG + Intronic
995387757 5:111607103-111607125 CTATTGGAGGCCGGGCACAATGG - Intergenic
996495605 5:124151540-124151562 CTGTTGGAGTTAGGGGAAAGGGG + Intergenic
999081278 5:148846121-148846143 CTGTAGGACTCTGGGCAAGATGG - Intergenic
1001166591 5:169374370-169374392 CTATTGGAGGCGGGGCATAGTGG + Intergenic
1004952955 6:20694781-20694803 ATGTTGGAGGAGGGGCCAAATGG + Intronic
1005342714 6:24858333-24858355 GTGTTGGGGTTGGGGCAAAAAGG + Intronic
1007214479 6:40226819-40226841 GTGTTGGAGGTGGGGCATAATGG - Intergenic
1010029496 6:71258280-71258302 CTCTTGGAGTCATTGCAAAATGG - Intergenic
1011620445 6:89237581-89237603 CTGTTGGAGTGGGGGCATGGCGG - Intergenic
1016282958 6:142440159-142440181 CTATAGGATTCGGGGGAAAACGG + Intronic
1016861716 6:148726725-148726747 CTGTTGGAGTTGGGGCCTAATGG - Intergenic
1019797337 7:3060781-3060803 CTGTTGGAGTGGATGTAAAATGG - Intergenic
1020368217 7:7403164-7403186 CTGTTGAAGTTGGGGTGAAAGGG + Intronic
1020755261 7:12192942-12192964 CTGTTGGAGATGGGGCTTAATGG + Intergenic
1023882043 7:44326147-44326169 CTGATGGAGACTGGGCAGAAGGG - Intronic
1031308131 7:120159908-120159930 CTAATGGAGTCAGGGGAAAATGG - Intergenic
1031874529 7:127123309-127123331 GTGTTGGAGGTGGGGCATAATGG + Intronic
1032594800 7:133228630-133228652 ATGTTGGAGTTGGGGCTTAATGG - Intergenic
1033471410 7:141653048-141653070 CTGCTGGAGTGGGGGCAGAGGGG - Exonic
1034266700 7:149784566-149784588 CTATTGGAGCCGGGACAGAAAGG + Intergenic
1034416419 7:150966771-150966793 CTGTTGGAGTCGGGGCAAAAGGG + Intronic
1034557657 7:151860220-151860242 CTGCTGGAGGCAGGGCAGAAAGG + Intronic
1035391690 7:158508592-158508614 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391703 7:158508649-158508671 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391715 7:158508706-158508728 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391727 7:158508763-158508785 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391739 7:158508820-158508842 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391752 7:158508877-158508899 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035782811 8:2242270-2242292 CTGTTGGAGGTGGGGGACAAGGG + Intergenic
1035809319 8:2477315-2477337 CTGTTGGAGGTGGGGGACAAGGG - Intergenic
1037260743 8:17004692-17004714 ATGTTGGACTCTGGGCAAAACGG - Intergenic
1038914803 8:32009239-32009261 CTGTTGGAGTAGGGGAATGATGG - Intronic
1043360956 8:79471401-79471423 GTGTTGGAGGTGGGGCCAAATGG - Intergenic
1045014236 8:97985359-97985381 GTGTTGGAGGCGGGGCTTAATGG - Intronic
1045601209 8:103718935-103718957 CTGTTGGAGGAGGGGCACAGTGG - Intronic
1047731284 8:127730853-127730875 GTGTTGGGGTCGGGGGAAACTGG + Intergenic
1051638439 9:19202643-19202665 CCGTTGAAGGCGGGGCACAATGG + Intergenic
1051945111 9:22559671-22559693 TTGTTGGAGGTGGGGCATAATGG + Intergenic
1058231786 9:102435385-102435407 ATGTTGGAGGTGGGGCATAATGG + Intergenic
1187759097 X:22559965-22559987 CTTTTGGAGTCCCAGCAAAAGGG - Intergenic
1191173429 X:57474355-57474377 CTGTTGGGGGCGGGGGACAAGGG - Intronic
1192789835 X:74370647-74370669 CAGTTGGACTCTGAGCAAAAGGG - Intergenic
1193155307 X:78166287-78166309 CTGCTAGAGTCTGGGGAAAAGGG + Intergenic
1196095319 X:111792301-111792323 CTGTTGGGGTCGGGGGCAAGGGG + Intronic
1199095944 X:143738663-143738685 CTGTTGGAGGGGTGGCAAGAGGG + Intergenic
1199293905 X:146135883-146135905 ATGTTGGAGGCGGGGCCTAATGG - Intergenic
1200175036 X:154108382-154108404 CTGTTGGAGGTGGGGCCAAGTGG - Intergenic
1200254343 X:154571764-154571786 CTGGAGGAGTTGGGGGAAAACGG + Intergenic
1200263426 X:154632644-154632666 CTGGAGGAGTTGGGGGAAAACGG - Intergenic