ID: 1034417028

View in Genome Browser
Species Human (GRCh38)
Location 7:150970672-150970694
Sequence GGTGCGGGCGGGGGTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034417028_1034417041 18 Left 1034417028 7:150970672-150970694 CCCCATGGACCCCCGCCCGCACC No data
Right 1034417041 7:150970713-150970735 TCCCACTCAGCCCTGTCTCCAGG No data
1034417028_1034417045 28 Left 1034417028 7:150970672-150970694 CCCCATGGACCCCCGCCCGCACC No data
Right 1034417045 7:150970723-150970745 CCCTGTCTCCAGGCTGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034417028 Original CRISPR GGTGCGGGCGGGGGTCCATG GGG (reversed) Intronic