ID: 1034417028 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:150970672-150970694 |
| Sequence | GGTGCGGGCGGGGGTCCATG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1034417028_1034417041 | 18 | Left | 1034417028 | 7:150970672-150970694 | CCCCATGGACCCCCGCCCGCACC | No data | ||
| Right | 1034417041 | 7:150970713-150970735 | TCCCACTCAGCCCTGTCTCCAGG | No data | ||||
| 1034417028_1034417045 | 28 | Left | 1034417028 | 7:150970672-150970694 | CCCCATGGACCCCCGCCCGCACC | No data | ||
| Right | 1034417045 | 7:150970723-150970745 | CCCTGTCTCCAGGCTGCACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1034417028 | Original CRISPR | GGTGCGGGCGGGGGTCCATG GGG (reversed) | Intronic | ||