ID: 1034418715

View in Genome Browser
Species Human (GRCh38)
Location 7:150978159-150978181
Sequence CCCCGCGGCTCGGCGGGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 355}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034418715_1034418730 25 Left 1034418715 7:150978159-150978181 CCGGCCCCCGCCGAGCCGCGGGG 0: 1
1: 0
2: 2
3: 44
4: 355
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034418715 Original CRISPR CCCCGCGGCTCGGCGGGGGC CGG (reversed) Exonic