ID: 1034418718

View in Genome Browser
Species Human (GRCh38)
Location 7:150978164-150978186
Sequence GCGGGCCCCGCGGCTCGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034418718_1034418730 20 Left 1034418718 7:150978164-150978186 CCCCGCCGAGCCGCGGGGCCCGC 0: 1
1: 1
2: 4
3: 30
4: 275
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418718_1034418734 28 Left 1034418718 7:150978164-150978186 CCCCGCCGAGCCGCGGGGCCCGC 0: 1
1: 1
2: 4
3: 30
4: 275
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034418718 Original CRISPR GCGGGCCCCGCGGCTCGGCG GGG (reversed) Exonic