ID: 1034418720 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:150978166-150978188 |
Sequence | GAGCGGGCCCCGCGGCTCGG CGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 185 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 11, 4: 171} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1034418720_1034418730 | 18 | Left | 1034418720 | 7:150978166-150978188 | CCGCCGAGCCGCGGGGCCCGCTC | 0: 1 1: 0 2: 2 3: 11 4: 171 |
||
Right | 1034418730 | 7:150978207-150978229 | CGCTCCGCCCGCCCGAGCCCCGG | 0: 1 1: 0 2: 3 3: 26 4: 273 |
||||
1034418720_1034418734 | 26 | Left | 1034418720 | 7:150978166-150978188 | CCGCCGAGCCGCGGGGCCCGCTC | 0: 1 1: 0 2: 2 3: 11 4: 171 |
||
Right | 1034418734 | 7:150978215-150978237 | CCGCCCGAGCCCCGGACTCCTGG | 0: 1 1: 0 2: 3 3: 26 4: 209 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1034418720 | Original CRISPR | GAGCGGGCCCCGCGGCTCGG CGG (reversed) | Exonic | ||