ID: 1034418720

View in Genome Browser
Species Human (GRCh38)
Location 7:150978166-150978188
Sequence GAGCGGGCCCCGCGGCTCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034418720_1034418730 18 Left 1034418720 7:150978166-150978188 CCGCCGAGCCGCGGGGCCCGCTC 0: 1
1: 0
2: 2
3: 11
4: 171
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418720_1034418734 26 Left 1034418720 7:150978166-150978188 CCGCCGAGCCGCGGGGCCCGCTC 0: 1
1: 0
2: 2
3: 11
4: 171
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034418720 Original CRISPR GAGCGGGCCCCGCGGCTCGG CGG (reversed) Exonic