ID: 1034418721

View in Genome Browser
Species Human (GRCh38)
Location 7:150978169-150978191
Sequence GCGGAGCGGGCCCCGCGGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034418721_1034418734 23 Left 1034418721 7:150978169-150978191 CCGAGCCGCGGGGCCCGCTCCGC 0: 1
1: 0
2: 1
3: 30
4: 214
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418721_1034418730 15 Left 1034418721 7:150978169-150978191 CCGAGCCGCGGGGCCCGCTCCGC 0: 1
1: 0
2: 1
3: 30
4: 214
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034418721 Original CRISPR GCGGAGCGGGCCCCGCGGCT CGG (reversed) Exonic