ID: 1034418723

View in Genome Browser
Species Human (GRCh38)
Location 7:150978182-150978204
Sequence GCGCGGGGACGCGGCGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 0, 2: 10, 3: 80, 4: 552}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034418723_1034418730 2 Left 1034418723 7:150978182-150978204 CCCGCTCCGCCGCGTCCCCGCGC 0: 1
1: 0
2: 10
3: 80
4: 552
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418723_1034418734 10 Left 1034418723 7:150978182-150978204 CCCGCTCCGCCGCGTCCCCGCGC 0: 1
1: 0
2: 10
3: 80
4: 552
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034418723 Original CRISPR GCGCGGGGACGCGGCGGAGC GGG (reversed) Exonic