ID: 1034418724

View in Genome Browser
Species Human (GRCh38)
Location 7:150978183-150978205
Sequence AGCGCGGGGACGCGGCGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034418724_1034418734 9 Left 1034418724 7:150978183-150978205 CCGCTCCGCCGCGTCCCCGCGCT 0: 1
1: 0
2: 4
3: 28
4: 357
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418724_1034418730 1 Left 1034418724 7:150978183-150978205 CCGCTCCGCCGCGTCCCCGCGCT 0: 1
1: 0
2: 4
3: 28
4: 357
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034418724 Original CRISPR AGCGCGGGGACGCGGCGGAG CGG (reversed) Exonic