ID: 1034418725

View in Genome Browser
Species Human (GRCh38)
Location 7:150978188-150978210
Sequence AGCGCAGCGCGGGGACGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034418725_1034418734 4 Left 1034418725 7:150978188-150978210 CCGCCGCGTCCCCGCGCTGCGCT 0: 1
1: 0
2: 4
3: 28
4: 226
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418725_1034418730 -4 Left 1034418725 7:150978188-150978210 CCGCCGCGTCCCCGCGCTGCGCT 0: 1
1: 0
2: 4
3: 28
4: 226
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034418725 Original CRISPR AGCGCAGCGCGGGGACGCGG CGG (reversed) Exonic