ID: 1034418726

View in Genome Browser
Species Human (GRCh38)
Location 7:150978191-150978213
Sequence CGGAGCGCAGCGCGGGGACG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034418726_1034418734 1 Left 1034418726 7:150978191-150978213 CCGCGTCCCCGCGCTGCGCTCCG 0: 1
1: 0
2: 0
3: 32
4: 234
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418726_1034418730 -7 Left 1034418726 7:150978191-150978213 CCGCGTCCCCGCGCTGCGCTCCG 0: 1
1: 0
2: 0
3: 32
4: 234
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034418726 Original CRISPR CGGAGCGCAGCGCGGGGACG CGG (reversed) Exonic