ID: 1034418730

View in Genome Browser
Species Human (GRCh38)
Location 7:150978207-150978229
Sequence CGCTCCGCCCGCCCGAGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 273}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034418718_1034418730 20 Left 1034418718 7:150978164-150978186 CCCCGCCGAGCCGCGGGGCCCGC 0: 1
1: 1
2: 4
3: 30
4: 275
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418725_1034418730 -4 Left 1034418725 7:150978188-150978210 CCGCCGCGTCCCCGCGCTGCGCT 0: 1
1: 0
2: 4
3: 28
4: 226
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418717_1034418730 21 Left 1034418717 7:150978163-150978185 CCCCCGCCGAGCCGCGGGGCCCG 0: 1
1: 0
2: 2
3: 28
4: 254
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418722_1034418730 10 Left 1034418722 7:150978174-150978196 CCGCGGGGCCCGCTCCGCCGCGT 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418720_1034418730 18 Left 1034418720 7:150978166-150978188 CCGCCGAGCCGCGGGGCCCGCTC 0: 1
1: 0
2: 2
3: 11
4: 171
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418724_1034418730 1 Left 1034418724 7:150978183-150978205 CCGCTCCGCCGCGTCCCCGCGCT 0: 1
1: 0
2: 4
3: 28
4: 357
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418723_1034418730 2 Left 1034418723 7:150978182-150978204 CCCGCTCCGCCGCGTCCCCGCGC 0: 1
1: 0
2: 10
3: 80
4: 552
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418719_1034418730 19 Left 1034418719 7:150978165-150978187 CCCGCCGAGCCGCGGGGCCCGCT 0: 1
1: 0
2: 2
3: 17
4: 189
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418715_1034418730 25 Left 1034418715 7:150978159-150978181 CCGGCCCCCGCCGAGCCGCGGGG 0: 1
1: 0
2: 2
3: 44
4: 355
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418721_1034418730 15 Left 1034418721 7:150978169-150978191 CCGAGCCGCGGGGCCCGCTCCGC 0: 1
1: 0
2: 1
3: 30
4: 214
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273
1034418726_1034418730 -7 Left 1034418726 7:150978191-150978213 CCGCGTCCCCGCGCTGCGCTCCG 0: 1
1: 0
2: 0
3: 32
4: 234
Right 1034418730 7:150978207-150978229 CGCTCCGCCCGCCCGAGCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034418730 Original CRISPR CGCTCCGCCCGCCCGAGCCC CGG Exonic