ID: 1034418734

View in Genome Browser
Species Human (GRCh38)
Location 7:150978215-150978237
Sequence CCGCCCGAGCCCCGGACTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 209}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034418721_1034418734 23 Left 1034418721 7:150978169-150978191 CCGAGCCGCGGGGCCCGCTCCGC 0: 1
1: 0
2: 1
3: 30
4: 214
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418726_1034418734 1 Left 1034418726 7:150978191-150978213 CCGCGTCCCCGCGCTGCGCTCCG 0: 1
1: 0
2: 0
3: 32
4: 234
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418719_1034418734 27 Left 1034418719 7:150978165-150978187 CCCGCCGAGCCGCGGGGCCCGCT 0: 1
1: 0
2: 2
3: 17
4: 189
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418727_1034418734 -5 Left 1034418727 7:150978197-150978219 CCCCGCGCTGCGCTCCGCCCGCC 0: 1
1: 1
2: 4
3: 64
4: 502
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418717_1034418734 29 Left 1034418717 7:150978163-150978185 CCCCCGCCGAGCCGCGGGGCCCG 0: 1
1: 0
2: 2
3: 28
4: 254
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418718_1034418734 28 Left 1034418718 7:150978164-150978186 CCCCGCCGAGCCGCGGGGCCCGC 0: 1
1: 1
2: 4
3: 30
4: 275
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418729_1034418734 -7 Left 1034418729 7:150978199-150978221 CCGCGCTGCGCTCCGCCCGCCCG 0: 1
1: 0
2: 7
3: 64
4: 352
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418720_1034418734 26 Left 1034418720 7:150978166-150978188 CCGCCGAGCCGCGGGGCCCGCTC 0: 1
1: 0
2: 2
3: 11
4: 171
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418722_1034418734 18 Left 1034418722 7:150978174-150978196 CCGCGGGGCCCGCTCCGCCGCGT 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418723_1034418734 10 Left 1034418723 7:150978182-150978204 CCCGCTCCGCCGCGTCCCCGCGC 0: 1
1: 0
2: 10
3: 80
4: 552
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418728_1034418734 -6 Left 1034418728 7:150978198-150978220 CCCGCGCTGCGCTCCGCCCGCCC 0: 1
1: 0
2: 2
3: 61
4: 473
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418725_1034418734 4 Left 1034418725 7:150978188-150978210 CCGCCGCGTCCCCGCGCTGCGCT 0: 1
1: 0
2: 4
3: 28
4: 226
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1034418724_1034418734 9 Left 1034418724 7:150978183-150978205 CCGCTCCGCCGCGTCCCCGCGCT 0: 1
1: 0
2: 4
3: 28
4: 357
Right 1034418734 7:150978215-150978237 CCGCCCGAGCCCCGGACTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034418734 Original CRISPR CCGCCCGAGCCCCGGACTCC TGG Exonic