ID: 1034422069

View in Genome Browser
Species Human (GRCh38)
Location 7:150995646-150995668
Sequence CAGGGGTGGGAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2151
Summary {0: 1, 1: 2, 2: 16, 3: 234, 4: 1898}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034422069 Original CRISPR CAGGGGTGGGAGAGGGAAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr