ID: 1034424737

View in Genome Browser
Species Human (GRCh38)
Location 7:151008634-151008656
Sequence GGCACACGGTAGCTCTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034424737_1034424741 2 Left 1034424737 7:151008634-151008656 CCTTCACAGAGCTACCGTGTGCC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1034424741 7:151008659-151008681 GCACTATGCTTCTCGGATCACGG 0: 1
1: 0
2: 0
3: 1
4: 44
1034424737_1034424742 3 Left 1034424737 7:151008634-151008656 CCTTCACAGAGCTACCGTGTGCC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1034424742 7:151008660-151008682 CACTATGCTTCTCGGATCACGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1034424737_1034424743 24 Left 1034424737 7:151008634-151008656 CCTTCACAGAGCTACCGTGTGCC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1034424743 7:151008681-151008703 GGATTAACACGCACCAGATAAGG 0: 1
1: 0
2: 0
3: 5
4: 38
1034424737_1034424739 -5 Left 1034424737 7:151008634-151008656 CCTTCACAGAGCTACCGTGTGCC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1034424739 7:151008652-151008674 GTGCCAAGCACTATGCTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034424737 Original CRISPR GGCACACGGTAGCTCTGTGA AGG (reversed) Intronic
900315171 1:2052660-2052682 GGCACCCGGTGCCTCTCTGAGGG + Intronic
903419790 1:23210414-23210436 GCCACACGGTGGTTGTGTGAGGG + Intergenic
910407659 1:86907120-86907142 GAAATAAGGTAGCTCTGTGATGG - Intronic
912561171 1:110552509-110552531 ACCAGACGGGAGCTCTGTGAGGG + Intergenic
914197999 1:145460078-145460100 GGCCCAGGGTCGCTCTGAGAGGG - Intergenic
914477101 1:148033210-148033232 GGCCCAGGGTCGCTCTGAGAGGG - Intergenic
915135858 1:153731016-153731038 GGCAATAGGTAGGTCTGTGATGG - Intronic
915364721 1:155308699-155308721 GGCGCACTGTGGCACTGTGACGG - Intergenic
915848818 1:159299042-159299064 GGCACACAGTTGCTATGTAAAGG - Intronic
919897469 1:202018277-202018299 GGAAGACGGCAGCTCTGGGAGGG + Intergenic
920390417 1:205596863-205596885 CCCACACGGTAAGTCTGTGAAGG + Intronic
920717853 1:208357884-208357906 GCCACACGATATCTCTGTGGAGG + Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1069063664 10:63920108-63920130 GGCTCCCAGAAGCTCTGTGATGG - Intergenic
1070608897 10:77919803-77919825 CGCCCACGGTATGTCTGTGATGG - Intronic
1070823614 10:79377998-79378020 TGCACACGGGAGATGTGTGAGGG + Intergenic
1076810393 10:132883574-132883596 GGCACACGGTCGCCCTGTGTGGG - Intronic
1076874837 10:133210936-133210958 GGCACCTGGGAGCTCTGGGAGGG + Intronic
1077122833 11:918186-918208 GGCACACGTCACCTCTGTTACGG + Intergenic
1077246996 11:1544536-1544558 TGCACAGGCTAGCTCTGTGGGGG - Intergenic
1077938198 11:6812953-6812975 GGAACACAGCAGCTCTGTGTAGG + Intergenic
1080212346 11:29800896-29800918 GGGAAAAGGAAGCTCTGTGAGGG + Intergenic
1080666702 11:34342661-34342683 GACCCACGGTAGGTCTGTGCTGG + Intronic
1081601353 11:44497066-44497088 TGCTCACGGTAACTCTATGAGGG - Intergenic
1081673655 11:44955856-44955878 GGGACACTGTTGCTCTGTGCTGG + Intergenic
1085593675 11:77789475-77789497 GGCACAGGCTACCTCTGTCAGGG + Intronic
1091950898 12:4592171-4592193 GGCAGATGGCAGCTCTGTGAAGG - Intronic
1092986604 12:13851857-13851879 TGCAGACAGTAGATCTGTGAAGG + Intronic
1104686346 12:130787489-130787511 GGGAGACTGGAGCTCTGTGACGG - Intergenic
1105287326 13:19015324-19015346 ATCACACAGCAGCTCTGTGATGG + Intergenic
1113456654 13:110454315-110454337 GGCACACAGTGGCTCTCTGAGGG - Intronic
1119860981 14:77935903-77935925 GCCACACGGGAGATCTGGGAGGG + Intergenic
1131147768 15:90025200-90025222 TGCAGACGGTGGCCCTGTGAGGG - Intronic
1133033128 16:3021051-3021073 GGGACACGGCAGCTCCGGGAGGG - Intronic
1133416583 16:5611834-5611856 TGCACACAGTAGCTGAGTGACGG - Intergenic
1135078111 16:19411344-19411366 GGCTCACAGAATCTCTGTGAGGG - Intronic
1141464059 16:84195287-84195309 GGCACGCGGGATCTCTGTGCAGG - Exonic
1141771196 16:86090621-86090643 GACACACGGTAGTTCTGCCAGGG + Intergenic
1146910791 17:36647190-36647212 GGCAGAGTGTAGCACTGTGAGGG + Intergenic
1154338198 18:13482425-13482447 AGCACACGGAAGCTCTGTATTGG + Intronic
1159493932 18:69176056-69176078 GGCCCAGGGCAGCACTGTGAAGG - Intergenic
1160918754 19:1510214-1510236 GGCACACTGTAGGTCTCGGAAGG + Exonic
1165244496 19:34490491-34490513 TGCCCTGGGTAGCTCTGTGAAGG + Intronic
1166561841 19:43737786-43737808 GGCACACAGTAGCTGCTTGAAGG - Intronic
925531909 2:4873439-4873461 GGCACACAGTATCTGTTTGACGG + Intergenic
930930277 2:56874408-56874430 GGTGCACGGTAGCCCTGTGCAGG - Intergenic
933989318 2:87622368-87622390 GGCACACGGTCCCTATGGGAGGG - Intergenic
935237114 2:101148906-101148928 GACACAGGGCAGCTCTGTGGTGG - Intronic
936304525 2:111328458-111328480 GGCACACGGTCCCTATGGGAGGG + Intergenic
936370869 2:111901176-111901198 GGCAAGCGGTGGCTCTCTGAAGG + Intronic
940255831 2:151728051-151728073 GGCACACTGTAGCCGTATGAAGG + Intronic
945055731 2:205867237-205867259 GGCACCTGGTAGCTCTTTGCTGG - Intergenic
947690890 2:232134884-232134906 CACACACGGTGGCTCTGGGAAGG + Intronic
1176052469 20:63127372-63127394 GGCACACGGTGCCTCTGTGTGGG - Intergenic
1176445871 21:6819984-6820006 AGTAAACGGTAGCTCTGTGCAGG - Intergenic
1176824039 21:13685017-13685039 AGTAAACGGTAGCTCTGTGCAGG - Intergenic
1179512787 21:41884902-41884924 GGCTCACGGTGGTTCTGGGAGGG - Intergenic
1180149942 21:45942318-45942340 AGCACGCGGCATCTCTGTGAAGG - Exonic
1181019800 22:20093695-20093717 GGCACAGCGCAGCTCTGGGAAGG + Intronic
1181046185 22:20215421-20215443 GTCACACGGCTGCTCTGTGGAGG - Intergenic
1181575586 22:23792434-23792456 GGGTCACGGCAGCTCTGTGCAGG + Intronic
1185045990 22:48528997-48529019 GGCACAGGGTAGCTGCCTGATGG + Intronic
1185157290 22:49201706-49201728 GGCTCACGGTCACTCTGTGGTGG - Intergenic
1185157306 22:49201782-49201804 GGCTCACGGTCACTCTGTGGTGG - Intergenic
950581659 3:13866237-13866259 GCCAGAAGGCAGCTCTGTGAGGG - Intronic
950855135 3:16097613-16097635 GCCACAGGGTAACTTTGTGAAGG + Intergenic
956541858 3:70348817-70348839 GGAACATGGGAGCTCTGCGAGGG + Intergenic
965482338 3:169234217-169234239 GGCACAGAGTACCTCTGTGGGGG - Intronic
968934568 4:3603166-3603188 GACACCCGGAAGCTCTGTAAAGG - Intergenic
970900702 4:21155655-21155677 GGAACACGGAAGCTCTATGCTGG + Intronic
975936437 4:79586972-79586994 GGAACATTGTAGCTCTTTGATGG - Intergenic
984820689 4:183879368-183879390 AGCACACGGTGGCTCTATGCTGG + Intronic
986446411 5:7825079-7825101 GGCACACTGCAGCGCTGTTATGG - Intronic
988460802 5:31435945-31435967 GGCACACAGTAGCTGTGCAATGG + Intronic
993000194 5:82373301-82373323 GGCACAGGGCAGCACCGTGAAGG + Intronic
997207175 5:132056780-132056802 GGCTCACGGAAGCGCTGTGGTGG + Intergenic
997517517 5:134501537-134501559 GGCACACAGAAGCTCTGCAAAGG + Intergenic
1002204428 5:177553436-177553458 GGGCCACGGTTGCTCTGGGAGGG - Intronic
1007997280 6:46321688-46321710 GGCACTCTGCAGCTCTGAGAAGG + Intronic
1008757142 6:54809829-54809851 GGGACATGGGAGTTCTGTGAGGG + Intergenic
1014887629 6:126801026-126801048 GGCCCACAGGAGCTCTGTCAGGG - Intergenic
1027249972 7:76393000-76393022 GTCACACGCTAGCTCTGGTAAGG + Intronic
1034424737 7:151008634-151008656 GGCACACGGTAGCTCTGTGAAGG - Intronic
1034514300 7:151562287-151562309 GGGCCACGGCAGCTCTGTGCCGG + Intronic
1034830811 7:154305816-154305838 GGCACAGGGAACCTCTGTCAAGG + Intronic
1037816000 8:22112169-22112191 GCCACAGGCTAGCTCTCTGAGGG + Intergenic
1039766472 8:40633562-40633584 GGTGCAGGGTAGCTCTGAGATGG - Intronic
1041199222 8:55434798-55434820 GGCACAGTGTAACTGTGTGAAGG - Intronic
1041560945 8:59216542-59216564 GGCACGCAGTAACTCTGTGCAGG + Intergenic
1042356576 8:67835018-67835040 GGCACACGGTCTCTGTGTGCAGG - Intergenic
1043463363 8:80482723-80482745 GGCTCACCATATCTCTGTGATGG - Intergenic
1043523740 8:81073971-81073993 GGCATGCTGTAGCTCTCTGAGGG - Intronic
1046097188 8:109575742-109575764 GGCACACAGTGGCTCTCTGAGGG - Exonic
1046181564 8:110655878-110655900 GGGACACTGTCGCTCTGTGTAGG - Intergenic
1049270528 8:141693301-141693323 GGCACACCTTACCTCTGTGCTGG - Intergenic
1051743592 9:20274644-20274666 GGAACACTGCAGCTCTGGGAGGG + Intergenic
1052694012 9:31853665-31853687 GGTACACAGTAGCCCTGTGCAGG - Intergenic
1057412552 9:94829872-94829894 GGCCCAAGGGAGTTCTGTGAAGG + Intronic
1060069924 9:120537290-120537312 GACTCATGGTAGCTCTTTGATGG - Intronic
1061761452 9:132854723-132854745 GGCAAACGGGAACTCCGTGAAGG - Intronic
1062217000 9:135394613-135394635 AGCAGACTGTGGCTCTGTGAGGG + Intergenic
1062298775 9:135851827-135851849 AGCACACGCAAGCTTTGTGATGG - Intronic
1203523322 Un_GL000213v1:64541-64563 AGTAAACGGTAGCTCTGTGCAGG + Intergenic
1192622561 X:72693756-72693778 GGGACACTGTATCTCTCTGAGGG - Intronic
1194467630 X:94253680-94253702 GACACACAGTAGATCTGTCAGGG - Intergenic
1196787089 X:119430437-119430459 GCCACTCACTAGCTCTGTGATGG - Intronic
1199424874 X:147689653-147689675 GGGACAAGGGAGCTCTCTGAGGG - Intergenic