ID: 1034425247

View in Genome Browser
Species Human (GRCh38)
Location 7:151010574-151010596
Sequence CTGGCGGGGCAGGATGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 325}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034425247_1034425260 7 Left 1034425247 7:151010574-151010596 CCCACTGCATCCTGCCCCGCCAG 0: 1
1: 0
2: 2
3: 21
4: 325
Right 1034425260 7:151010604-151010626 GACGCTACGAGGAGTGGAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 64
1034425247_1034425256 1 Left 1034425247 7:151010574-151010596 CCCACTGCATCCTGCCCCGCCAG 0: 1
1: 0
2: 2
3: 21
4: 325
Right 1034425256 7:151010598-151010620 ATCCCCGACGCTACGAGGAGTGG 0: 1
1: 0
2: 0
3: 1
4: 14
1034425247_1034425261 29 Left 1034425247 7:151010574-151010596 CCCACTGCATCCTGCCCCGCCAG 0: 1
1: 0
2: 2
3: 21
4: 325
Right 1034425261 7:151010626-151010648 GTTCCGCTGCCCCACGCTGCTGG 0: 1
1: 0
2: 1
3: 13
4: 113
1034425247_1034425255 -4 Left 1034425247 7:151010574-151010596 CCCACTGCATCCTGCCCCGCCAG 0: 1
1: 0
2: 2
3: 21
4: 325
Right 1034425255 7:151010593-151010615 CCAGGATCCCCGACGCTACGAGG 0: 1
1: 0
2: 0
3: 6
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034425247 Original CRISPR CTGGCGGGGCAGGATGCAGT GGG (reversed) Intronic
900137038 1:1122074-1122096 CTGGCTGGGCAGGAGGCTGGGGG + Intergenic
900322730 1:2093150-2093172 CTGGCGGGAGAGGAGGCAGATGG + Intronic
900408724 1:2503543-2503565 CTGGAGGGGCAGGGTGGTGTGGG - Intronic
900780149 1:4612613-4612635 CTGGTGGGGCAGGAGGCACAGGG - Intergenic
901771845 1:11534567-11534589 CTGGGTGGGCAGGAGGCAGAGGG + Intronic
902627003 1:17682704-17682726 CTGAGGGGGCAGGAAGCACTGGG + Intronic
903681355 1:25099459-25099481 CTGGCAGAGCAGGAAGCAGGTGG - Intergenic
904411851 1:30329448-30329470 CCGGCGGGGCGGGAGGAAGTCGG - Intergenic
905025200 1:34845015-34845037 CTGGCTGGGCAGAAGGCAGCAGG + Intronic
905577378 1:39056089-39056111 CGGGAGGGGGAGGTTGCAGTGGG + Intergenic
905658252 1:39700429-39700451 CTGGGGTGGCAGGAAGCACTTGG - Intronic
905701733 1:40021414-40021436 CTGGAGGTGGAGGTTGCAGTGGG + Intergenic
906534030 1:46541657-46541679 CTGGAGGCGGAGGTTGCAGTGGG - Intergenic
907365825 1:53958957-53958979 CTGGAGGTGGAGGTTGCAGTGGG - Intronic
908163870 1:61438301-61438323 CTGGCTGGGCAGGGTGCTGAGGG - Intronic
909019329 1:70413813-70413835 CAGGAGGTGGAGGATGCAGTGGG - Intronic
912251288 1:108014989-108015011 TTGGGTGGGCAGGAAGCAGTAGG - Intergenic
912695985 1:111842484-111842506 CAGGCTGGGAAAGATGCAGTGGG + Intronic
912796375 1:112695966-112695988 CAGGCGGCGGAGGTTGCAGTGGG + Intronic
915076213 1:153309789-153309811 CTGGCAGGGCAGGAACCAGGAGG + Intronic
915527133 1:156482855-156482877 CTGAAGGGGCAGGATTCAGGTGG + Intronic
918145760 1:181754128-181754150 CCTGCAGGGCAGGATTCAGTGGG + Intronic
919207163 1:194432190-194432212 CTGGAGGTGGAGGTTGCAGTGGG + Intergenic
919806790 1:201385305-201385327 GTGGCAGGGCAGGGAGCAGTAGG + Intronic
919944732 1:202310851-202310873 CTGGAGGTGCAGGATGGACTTGG - Intronic
920504182 1:206505214-206505236 CTGGTGGGGCAAGAAGCAGCAGG - Intergenic
921034961 1:211368155-211368177 CTTGCTGGGCAGGATGCATGTGG + Intronic
921675372 1:217969683-217969705 TTGGCCGGGCAGGCTGCACTTGG - Intergenic
923138853 1:231142976-231142998 CTGGCAGTGCAGGATGGAGAAGG + Intergenic
923451300 1:234120030-234120052 CTGGAGGTGCAGGCTGCAGAAGG + Intronic
923674243 1:236065761-236065783 CTGGCGGGGAAAGCTGCAGGTGG + Intergenic
924247551 1:242099546-242099568 CTGCAGGGGCGGGAGGCAGTGGG + Intronic
924454086 1:244204226-244204248 CAGGCAGGGCAGGCTGCTGTAGG - Intergenic
1062913653 10:1231025-1231047 CTGGCTGGAGAGGCTGCAGTTGG + Intronic
1064162849 10:12960640-12960662 GAGGTGGGGCAGGGTGCAGTCGG + Intronic
1066185923 10:33010466-33010488 CTAGGAGGGCAGGAAGCAGTTGG - Intergenic
1066975624 10:42365640-42365662 CTGGGAGGTGAGGATGCAGTGGG + Intergenic
1067042127 10:42960545-42960567 CTGGCAGGACAGGAGGCAGCAGG + Intergenic
1067661885 10:48242268-48242290 CAGGCGGTGCACGTTGCAGTCGG - Exonic
1067824256 10:49558643-49558665 CTGGAGGCGGAGGTTGCAGTGGG - Intergenic
1069669403 10:70189134-70189156 CCAGTGGGGCAGGATGCAGTGGG - Intergenic
1070835706 10:79445704-79445726 CGGGCGGGGCGGGACGCAGTGGG - Intergenic
1071165246 10:82798900-82798922 CTGGCTGGGCTGGAGTCAGTTGG + Intronic
1071471402 10:85986552-85986574 CGGGAGAGGCAGGTTGCAGTTGG - Intronic
1072577520 10:96713796-96713818 CTGGTGAGGCAGGATCCAGGGGG - Intronic
1073156990 10:101354695-101354717 CGGGCAGGGCTGGATGCAGATGG + Intronic
1073464740 10:103687870-103687892 CTGGCTGCTCATGATGCAGTAGG - Intronic
1073646803 10:105313305-105313327 CTAGAGGGGCTGGATGAAGTCGG + Intergenic
1074310471 10:112317997-112318019 CGGGCAGGGAAGGTTGCAGTGGG + Intergenic
1074533142 10:114310623-114310645 CCAGCTGGGCAGGCTGCAGTGGG + Intronic
1075774702 10:124974869-124974891 CAGGAGGTGGAGGATGCAGTGGG - Intronic
1076012906 10:127004751-127004773 GTGGCGGGGCAGGGGGCCGTTGG - Intronic
1076298208 10:129403653-129403675 CTGGCAGCGCAGCATGAAGTCGG - Intergenic
1076478608 10:130769411-130769433 GTGGCTGGGCAGGGTGCAGGTGG - Intergenic
1076550645 10:131275824-131275846 CTGGTGGGGCAGATGGCAGTAGG + Intronic
1077118450 11:896006-896028 GTGGGAGGGCAGGAGGCAGTAGG - Intronic
1077352377 11:2098927-2098949 GTGGAGGGGCAGGATCCAGGAGG - Intergenic
1077408594 11:2393352-2393374 CTGGCTGGGCAGCATGCACCTGG - Intronic
1077474051 11:2778157-2778179 GTTGCTGGGCAGGCTGCAGTAGG - Intronic
1077539667 11:3140599-3140621 CTGGTGGGGCAGCATGTACTTGG - Intronic
1079060268 11:17242294-17242316 CTGGAGGGAGAGGTTGCAGTGGG + Intronic
1079316203 11:19409921-19409943 CAGGCGGCTCAGGATTCAGTGGG + Intronic
1079407631 11:20160017-20160039 CTGGCAGGGGAGAAGGCAGTCGG + Exonic
1079441588 11:20520271-20520293 CTGGGGAGGGAGGATGCGGTGGG + Intergenic
1080007940 11:27429407-27429429 CTGGAGGCGGAGGTTGCAGTGGG + Intronic
1080264336 11:30385873-30385895 CTGGCATGGCAGGGTGGAGTGGG - Intronic
1081626918 11:44661563-44661585 CTGGCGGGGCTGGCTGGGGTTGG - Intergenic
1081982466 11:47276588-47276610 ATGGTGGGGCAGGGGGCAGTGGG + Intronic
1083641529 11:64148294-64148316 GTGGAGGGGAAGGGTGCAGTGGG - Intronic
1083672207 11:64305815-64305837 CGGGCGGGGCGGGCTGCAGGCGG + Intronic
1083756071 11:64792276-64792298 CTGGCAGGGGAGCAGGCAGTGGG + Intronic
1086430758 11:86734085-86734107 CAGGAGGTGCAGGTTGCAGTGGG - Intergenic
1087551699 11:99658812-99658834 CAGGAGGTGGAGGATGCAGTGGG + Intronic
1088405935 11:109479078-109479100 CTGCCAGGGCAGGAAGCAGTAGG + Intergenic
1089957730 11:122587655-122587677 CAGGAGGGGGAGGTTGCAGTGGG - Intergenic
1090459373 11:126876609-126876631 CTGGAGGTGGAGGTTGCAGTGGG - Intronic
1091068109 11:132536139-132536161 CTGGAGGGACAGGATGCTGAGGG - Intronic
1091128917 11:133127557-133127579 CGGGAGGTGGAGGATGCAGTGGG + Intronic
1091569462 12:1671857-1671879 CTGGGGGCGGAGGTTGCAGTGGG + Intergenic
1092806186 12:12225210-12225232 CTGGCCGGGGTGGACGCAGTGGG + Intronic
1095752630 12:45729075-45729097 CTGGCGGGGAGGGAAGCAGGCGG + Intergenic
1096428499 12:51523926-51523948 CTGGTGGGGCAGGAGGCTCTGGG - Intergenic
1096844525 12:54398618-54398640 CTGCCGAGGCAGGATTCGGTAGG + Exonic
1097288504 12:57895544-57895566 CTGGCTGTGCAGGATGCAGAGGG + Intergenic
1097899938 12:64862519-64862541 GGGGCAGGGCAGGGTGCAGTAGG + Intronic
1099048870 12:77759079-77759101 CTGGCGTGGCAGGGTGCAGTGGG - Intergenic
1101454881 12:104820713-104820735 CAGGAGGGGGAGGTTGCAGTGGG - Intronic
1101946185 12:109139309-109139331 CTAGTGGGGCAGGAGGCTGTTGG - Intronic
1102365882 12:112334133-112334155 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
1102659098 12:114509741-114509763 CTGTCGGGGGAGGATGGGGTGGG + Intergenic
1103505486 12:121440076-121440098 CTGGTGGGGCAGGAAGGAGGGGG + Intronic
1103775097 12:123361472-123361494 CGGGAGGGGGAGGTTGCAGTGGG + Intronic
1105007575 12:132730739-132730761 CAGGAGGGGGAGGCTGCAGTGGG + Intronic
1105413574 13:20191683-20191705 CAGGCGGTGCAGGATGGCGTGGG - Intronic
1105535236 13:21259679-21259701 CGGGCGGGGCGGGCTGCAGGCGG + Intergenic
1105818575 13:24059255-24059277 CAGGCCAGGCCGGATGCAGTGGG - Intronic
1107851682 13:44577480-44577502 CTGGCGGGGCAGGAGGCGGCGGG + Intergenic
1108124978 13:47232633-47232655 CTGGCTGCTAAGGATGCAGTAGG - Intergenic
1109687927 13:65844722-65844744 CTGGCCCGGCAGGCTGCACTCGG - Intergenic
1110229032 13:73149273-73149295 CAGGAGGTCCAGGATGCAGTGGG + Intergenic
1111988095 13:95085652-95085674 CTGGTGGGTCAAGATGCAGGTGG - Intronic
1115582720 14:34777568-34777590 CAGGAGGGGGAGGTTGCAGTGGG + Intronic
1119035944 14:71230920-71230942 CAGGGTGGGCACGATGCAGTTGG - Intergenic
1119073371 14:71609877-71609899 CTGGCAGGGCAGGGTGGGGTGGG - Intronic
1119124780 14:72115582-72115604 CTGAGGGGGCAGGAAGCAGATGG - Intronic
1119190800 14:72680439-72680461 CTGGCGGGGAAGCAGACAGTAGG + Intronic
1119581383 14:75785252-75785274 CTGGAGGTGGAAGATGCAGTGGG - Intronic
1121338077 14:93089256-93089278 CTGGCATGTCAGGATGCTGTGGG + Intronic
1122082220 14:99273922-99273944 CTGGCCGGGCAGGCTGCACCCGG + Intergenic
1122453968 14:101835239-101835261 CTGGGGGAGCAGGATGAATTGGG + Intronic
1123704329 15:22940094-22940116 CTGGCAGGGCAGGGTGAAGGTGG + Intronic
1124621976 15:31279042-31279064 CTGCTGGGGCAGGGTGGAGTGGG - Intergenic
1124629008 15:31326741-31326763 CTGGCGGCGCAGGTTACAGGCGG - Intergenic
1125829420 15:42703435-42703457 CTGGAGGCGGAGGCTGCAGTGGG - Intronic
1126106281 15:45149006-45149028 CTGGTGGGGCAGGAAGTAGGGGG - Intronic
1128590164 15:68888475-68888497 CTGGGGGCGCAGGTTGCAGGAGG - Intronic
1128765924 15:70251088-70251110 CTAGCAGGGCAGGAGGCTGTGGG - Intergenic
1128877371 15:71213442-71213464 CTGGCTGGGCAGGGTGAAGGCGG - Intronic
1129308409 15:74686249-74686271 CGGGAGGCGGAGGATGCAGTGGG + Intronic
1129755535 15:78096567-78096589 CTGGAGGCGGAGGTTGCAGTGGG - Intronic
1132047378 15:98575918-98575940 CTGGAGGCGGAGGTTGCAGTGGG + Intergenic
1132546481 16:535637-535659 CTGGAGGGGCAGGGTGCGGAGGG - Intronic
1132809310 16:1789971-1789993 GTGGCGGGGCAGGATCCAGGCGG + Intronic
1134091453 16:11393646-11393668 CTGGCTGGGGAGGCTGCTGTTGG + Intronic
1134278467 16:12797479-12797501 CAGGAGGGGGAGGCTGCAGTGGG + Intronic
1135809259 16:25572641-25572663 CTGATGTGGCTGGATGCAGTGGG - Intergenic
1136280805 16:29210136-29210158 CTGGGGTGGCAGGAGGCAGGTGG - Intergenic
1138364539 16:56463494-56463516 CGGGAGGTGGAGGATGCAGTGGG - Intronic
1140529168 16:75648933-75648955 CAGGAGGTCCAGGATGCAGTAGG - Intronic
1141697722 16:85628027-85628049 CTGGAGGGGCAGGAGGCACGTGG + Intronic
1142085162 16:88176058-88176080 CTGGGGTGGCAGGAAGCAGGTGG - Intergenic
1142656239 17:1396348-1396370 CTGGAGGCGGAGGTTGCAGTGGG + Intronic
1144079281 17:11747818-11747840 GTGGCGGGCTTGGATGCAGTTGG + Intronic
1144599193 17:16598073-16598095 CTGGCCAGGCAGGCAGCAGTAGG + Intergenic
1144767012 17:17738388-17738410 CTGGCGGGGCGGGGTGGGGTGGG + Intronic
1145126022 17:20300712-20300734 CAGCCGTGGCAGCATGCAGTGGG + Intronic
1147602572 17:41755323-41755345 CTGGAGGCGCAGGGTGCAGCAGG + Exonic
1147651997 17:42068062-42068084 CAGGCAGGGCAGGCTGCAGCAGG - Intergenic
1148078934 17:44956692-44956714 CTGGAGGTGGAGGTTGCAGTGGG + Intergenic
1148922546 17:51051644-51051666 CTGGAGGCGGAGGTTGCAGTGGG + Intronic
1150629223 17:66866616-66866638 CTGTCAGTGCAGGAGGCAGTGGG - Intronic
1151792533 17:76317448-76317470 CGGGAGGTGGAGGATGCAGTGGG + Intronic
1152233343 17:79125746-79125768 CCGGCGGGGCAGGCTGCAGTGGG + Intronic
1152640722 17:81448184-81448206 CTGGCAGAGCAGGAGGCAGGCGG - Intronic
1153805023 18:8704151-8704173 CTGGCGTTGCAGGAGGCAGAGGG - Intergenic
1154244093 18:12679980-12680002 CAGGAGGGGGAGGCTGCAGTGGG + Intronic
1156730305 18:40186313-40186335 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
1160003372 18:75048969-75048991 TTGGCTGGCCTGGATGCAGTGGG + Intronic
1161218090 19:3104746-3104768 CTGGCGAGGCAGGCTGCAGACGG + Intronic
1161610384 19:5238818-5238840 CAGGCGGGGCCTGCTGCAGTGGG - Intronic
1162348431 19:10134782-10134804 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
1162475377 19:10896442-10896464 CTGGCCAGGCAGGAGGCAATGGG - Intronic
1162610709 19:11748753-11748775 CAGGCTGGGCCGGGTGCAGTGGG + Intergenic
1162793385 19:13074406-13074428 CTGGCGGGGCACCCTGCAGAGGG + Intronic
1163124303 19:15236500-15236522 GTGGGGGGACAGGATGGAGTAGG + Exonic
1165094871 19:33404733-33404755 CTCGCTGGGCAGGATGGAGCTGG - Intronic
1165310131 19:35024701-35024723 AGGGCGGGGCAGGATGGGGTGGG + Intronic
1166068899 19:40376568-40376590 GAGGTGGGGCAGGATGCAGAGGG - Intronic
1166445799 19:42856541-42856563 CTGGTGGTGCAGGAGGAAGTGGG + Intronic
1166925823 19:46266698-46266720 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
1167685584 19:50953904-50953926 CTGGAGGCGGAGGTTGCAGTGGG - Intergenic
1167848502 19:52183948-52183970 CGGGAGGGGGAGGTTGCAGTGGG + Intergenic
1168332408 19:55578260-55578282 CTGGTGGCGCAGGAGGCTGTAGG + Exonic
927827544 2:26319104-26319126 CTGGCAGGGCAGTGTGCAGATGG + Intronic
929882697 2:45851021-45851043 CTGGTAGGGCAGGGTGCTGTGGG + Intronic
931747246 2:65301047-65301069 TTGGCGGGGAAGGAAGCAGTGGG - Intergenic
932208425 2:69906101-69906123 CTGGCGGGAGAGGTTGCAGTGGG - Intronic
932802641 2:74755497-74755519 CTGCCGTGTAAGGATGCAGTAGG - Intergenic
934718278 2:96555490-96555512 CTGGCAGGGGAGGAAGCAGAGGG + Intergenic
934964953 2:98713110-98713132 CTGGAGATGGAGGATGCAGTGGG + Intronic
935171014 2:100611629-100611651 CTGGCAGGGCAGAATGAAGCTGG + Intergenic
935220807 2:101010806-101010828 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
935418655 2:102844349-102844371 CTGGAGGGTCAGGAGGCAATAGG + Intergenic
935597884 2:104893807-104893829 CTGGAGGCGGAGGTTGCAGTGGG + Intergenic
936051176 2:109224781-109224803 CTGGAGAGGGAGGTTGCAGTGGG + Intronic
937132618 2:119524505-119524527 CTGGCAGGGGAGGAGGCAGAGGG + Intergenic
940369840 2:152889051-152889073 CGGGGAGGACAGGATGCAGTGGG + Intergenic
941703658 2:168634484-168634506 CAGGAGGGGTAGGTTGCAGTGGG - Intronic
942034360 2:171996368-171996390 CTGGAGGCGGAGGTTGCAGTGGG - Intronic
942447549 2:176088126-176088148 CTGGGGCTGCAGGGTGCAGTGGG + Intergenic
943454397 2:188085492-188085514 CTGGGGCTGGAGGATGCAGTAGG - Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946297071 2:218793786-218793808 CTGGGGGCGGAGGTTGCAGTGGG - Intronic
946339777 2:219059815-219059837 CTGGAGGCGCAGGAGGCAGCCGG + Intronic
948288027 2:236802419-236802441 CAGGAGGGGGAGGTTGCAGTGGG - Intergenic
948686967 2:239675879-239675901 CTGGAGGGGCAGGAGGCGGGGGG - Intergenic
948863271 2:240763125-240763147 CAGGAGGGGCAGCAGGCAGTTGG + Intronic
948970038 2:241418374-241418396 CCTGGGGGGCAGGAGGCAGTGGG - Intronic
1170009323 20:11704342-11704364 CTGGCATGGCATGATGCAATGGG + Intergenic
1170226971 20:14001737-14001759 CTTACGGGGCAAGATGAAGTAGG + Intronic
1172621427 20:36320457-36320479 CTGCCAGGGCAGGTGGCAGTGGG + Intronic
1172870376 20:38132013-38132035 CTGGTGGGGCAGGGTGGGGTGGG - Intronic
1173190186 20:40870051-40870073 CAGGCAGGGCAGGATAGAGTGGG - Intergenic
1173199738 20:40945685-40945707 GTGCCGGGGCAGGGAGCAGTGGG - Intergenic
1174133603 20:48363243-48363265 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
1175304594 20:57967138-57967160 CTGGCTGGGAAGAAGGCAGTGGG + Intergenic
1175466521 20:59193731-59193753 CTGGGGCTGCAGGATGCAGTGGG - Exonic
1175780135 20:61676919-61676941 GTGGTGGGCCAGGCTGCAGTGGG + Intronic
1176363990 21:6021581-6021603 CTGGGAGGGCAGGCTGCAGCCGG + Intergenic
1179505800 21:41839538-41839560 CTGGCGGGGCAGGGGGCAGAGGG - Intronic
1179759528 21:43516964-43516986 CTGGGAGGGCAGGCTGCAGCCGG - Intergenic
1179907954 21:44433952-44433974 CTGGCGGGGCAGCCTCCAGCTGG - Intronic
1180861065 22:19083198-19083220 CAGTCGGAGAAGGATGCAGTTGG - Intronic
1181169802 22:21001668-21001690 CCGGCGGGACTGAATGCAGTCGG - Intronic
1182284123 22:29234086-29234108 GTGTTGGGGCAGGATGGAGTGGG - Intronic
1182517830 22:30869080-30869102 CAGGTGGGGCAGGAGGCAGCTGG - Intronic
1183294723 22:37022778-37022800 CTGGCAGGACTGCATGCAGTGGG + Intronic
1183498877 22:38166242-38166264 GTGGAAGGGCAGGATGCAGAAGG - Intronic
1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG + Intergenic
1183893545 22:40950417-40950439 CTGGAGGCGGAGGTTGCAGTGGG + Intergenic
1183933923 22:41251006-41251028 ATGGCAGTGCAGGATGCAGTAGG - Exonic
1184461966 22:44643295-44643317 CAGGAGGCGGAGGATGCAGTGGG + Intergenic
1184595211 22:45509704-45509726 CAGGAGGGGCAGGGTGCAGGTGG + Intronic
1184900248 22:47442217-47442239 CTTATGGGGCAGAATGCAGTGGG + Intergenic
950199996 3:11035962-11035984 CTGACGGGGCAGGATGGCGAAGG + Intronic
950794158 3:15497115-15497137 CTGGAGGCGGAGGTTGCAGTGGG - Intronic
952959941 3:38582960-38582982 CTGTGGGGGAAGGATCCAGTGGG - Intronic
953532721 3:43752756-43752778 CTGGTGGGGCAGAAAGCAGCTGG - Intergenic
954879562 3:53824133-53824155 CTGCCGGGACAGGGTGCAGCAGG + Intronic
957845037 3:85721427-85721449 TTGGCCTGGCAGGATGCACTCGG + Intronic
957912196 3:86634556-86634578 CCAGGGGGGCAGGATGCAGTGGG - Intergenic
958685895 3:97393658-97393680 CTGGCATGGCAGGAGGAAGTAGG + Intronic
962181700 3:133212790-133212812 CGGGCGGCGGAGGTTGCAGTAGG + Intronic
962491628 3:135898891-135898913 CAAGGGGGGCAGGATTCAGTCGG - Intergenic
962701500 3:138004098-138004120 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
963084277 3:141422290-141422312 GAGGTGGGGCAGGATGCAGGAGG - Intronic
964105766 3:153038178-153038200 CAGGAGGTGCAGGTTGCAGTGGG - Intergenic
964669642 3:159210742-159210764 CGGGAGGGGGAGGTTGCAGTGGG - Intronic
965015557 3:163152962-163152984 CAGGAGGGGGAGGTTGCAGTGGG - Intergenic
965118802 3:164523382-164523404 CTGGAGGGGGAGGTTGCAGTGGG - Intergenic
966850414 3:184161351-184161373 CGGGAGGCGCAGGTTGCAGTGGG + Intronic
967999374 3:195193212-195193234 CGGGAGGTGGAGGATGCAGTGGG + Intronic
968459051 4:714693-714715 CTGGCCTGGCAGAAGGCAGTGGG - Intronic
968729829 4:2264467-2264489 CTGGGGGAGCAGGAAGGAGTTGG + Intergenic
971267623 4:25108991-25109013 CTGGGTGGGGAGGAAGCAGTCGG - Intergenic
971937511 4:33171282-33171304 CTGGAGGTGGAGGCTGCAGTGGG + Intergenic
973234206 4:47880338-47880360 CAGGAGGTGCAGGCTGCAGTGGG + Intronic
975590280 4:75992859-75992881 CTGGGAGGGCAGGGTGCAGCAGG + Intergenic
977818794 4:101447454-101447476 CTAGAGAAGCAGGATGCAGTAGG + Intronic
979807242 4:124989460-124989482 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
981013260 4:139948024-139948046 CTGGGAGGGTAGGTTGCAGTGGG + Intronic
982258852 4:153476030-153476052 CAGGAGGGGGAGGTTGCAGTAGG - Intronic
982260308 4:153488617-153488639 CTGAGGGGGCTGGATGGAGTAGG + Intronic
984949448 4:184995986-184996008 GGGGCAGGGCAGGAGGCAGTGGG + Intergenic
985575491 5:671732-671754 CTGGCAGGGCAGGATGAACGTGG - Intronic
985696633 5:1344701-1344723 CAGGTAGGGCTGGATGCAGTTGG + Exonic
985882891 5:2653936-2653958 CTGTGGGGACAGGATCCAGTAGG - Intergenic
987882903 5:23772739-23772761 CGGGCTGGGCAGAATGCAGCCGG - Intergenic
991078366 5:62567634-62567656 CAGGCGGCGGAGGTTGCAGTGGG - Intronic
991243956 5:64489449-64489471 ATGGTGGGGGAGGCTGCAGTGGG - Intergenic
991388662 5:66118065-66118087 CTGGAGGCGGAGGTTGCAGTGGG + Intergenic
992295429 5:75322337-75322359 CTGGTGGGGGAGAATTCAGTAGG + Intergenic
994209662 5:97073619-97073641 CTGGAGGGGGAGCATGCAGACGG - Intergenic
994316551 5:98339654-98339676 ATGGCAGGACAGGATGCAGAAGG + Intergenic
998527508 5:142856270-142856292 CTGGAGGGCCAGGTGGCAGTCGG + Intronic
999144253 5:149382014-149382036 CTGGCGGGGCCTGCTGCAGAGGG - Intronic
999892385 5:155993167-155993189 ATGGCGGGGCAAGAGGCAGAAGG - Intronic
1000353372 5:160370412-160370434 CGGGCGGGGCGGGATGCGGAAGG - Intronic
1003807177 6:9738221-9738243 GTGGCAGGTCAGGATGCTGTGGG - Intronic
1003884219 6:10506182-10506204 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
1004137098 6:12978116-12978138 CAGGCCAGGCAGGATGCGGTTGG - Intronic
1005946416 6:30599161-30599183 CAGGAGGTGCAGGTTGCAGTGGG - Intergenic
1006431806 6:34001839-34001861 CTGGCCGGGCAGGAAGGAGGTGG + Intergenic
1006438034 6:34036535-34036557 TTGGCAGGGCAGGCTGCAGATGG + Exonic
1006558186 6:34887226-34887248 CAGGAGGCGCAGGTTGCAGTGGG + Intronic
1007395020 6:41572773-41572795 CTGGCTGGGCAGGATGGAGGAGG - Intronic
1007560034 6:42799952-42799974 CTGGGGGCGGAGGTTGCAGTCGG - Intronic
1007688169 6:43679828-43679850 CTTGGGAGGCAGGTTGCAGTGGG + Intronic
1007774992 6:44219807-44219829 CTGGCGGGGCGGGGTGGGGTGGG + Intronic
1008538618 6:52527302-52527324 CAGGAGGTGGAGGATGCAGTGGG + Intronic
1008562046 6:52733269-52733291 CAGGTGGGGCAGGAGGCTGTGGG + Intergenic
1011277426 6:85643690-85643712 CTGGCGGGGCAGAGTGCTGTGGG + Intronic
1012015202 6:93841225-93841247 CGGGAGGTGCAGGTTGCAGTGGG + Intergenic
1013041208 6:106435673-106435695 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
1013459422 6:110360397-110360419 CTGGGGGTGGAGGATGGAGTGGG + Intergenic
1014539211 6:122653537-122653559 CTGGTGGGGCGGGATGAGGTGGG + Intronic
1016975439 6:149802977-149802999 CTGGAGGCGGAGGTTGCAGTGGG + Intronic
1017786704 6:157762685-157762707 GTGGCTAGGGAGGATGCAGTGGG + Intronic
1018005790 6:159620298-159620320 CTGGTGGGGCATTATGCTGTAGG - Intergenic
1018438741 6:163788686-163788708 GTGGCTCTGCAGGATGCAGTGGG + Intergenic
1019427641 7:984892-984914 CTGGCGGGGCTGGCTGGGGTGGG + Intronic
1020605641 7:10333332-10333354 CAGGAGGTGGAGGATGCAGTGGG + Intergenic
1022630660 7:32081458-32081480 ATTTCAGGGCAGGATGCAGTGGG - Intronic
1022722955 7:32957348-32957370 CGGGCGGGGCAGGGCGCAGCAGG + Intergenic
1022855397 7:34309254-34309276 CTGGAGGGGAAGCATGCAGACGG + Intergenic
1023381180 7:39609885-39609907 CAGGCGGGGCAGGCTGCTGCAGG - Intronic
1023678616 7:42658986-42659008 CTGGCGTCACAGGATGCATTTGG - Intergenic
1023912910 7:44568084-44568106 CTGACAGGGCAGGAGGCAGCAGG - Intronic
1027144327 7:75683526-75683548 CTGGAGGGGCAGGAGGAAGCTGG + Intronic
1027809957 7:82883842-82883864 CTGGAGGCGGAGGTTGCAGTGGG - Intronic
1028923576 7:96332761-96332783 TTGGAGGGGCAGGATGGAGTAGG + Intergenic
1028985627 7:97006451-97006473 CGGGCGGGGTAGGGGGCAGTCGG - Intronic
1029101038 7:98130178-98130200 CTGGCGGGGAGTGATGGAGTCGG + Intronic
1029240652 7:99159397-99159419 CAGGTGGGGCAGGGGGCAGTTGG + Intergenic
1029254386 7:99259530-99259552 CTGGAGGCGGAGGTTGCAGTGGG - Intergenic
1031067327 7:117119091-117119113 GGGGCGGGGCAGGAAGGAGTGGG - Intronic
1033180060 7:139167865-139167887 CTGGGGGTGGAGGTTGCAGTGGG + Intronic
1033223823 7:139545494-139545516 CTGCCTGGGGAGGAAGCAGTCGG + Intergenic
1034425247 7:151010574-151010596 CTGGCGGGGCAGGATGCAGTGGG - Intronic
1034670763 7:152856497-152856519 CGGGCGGGGCAGGGTGGAGATGG - Intergenic
1034989055 7:155536102-155536124 CTGGCGGGGTCAGAGGCAGTGGG + Intergenic
1035035962 7:155893899-155893921 GTGGCGTGGCCAGATGCAGTGGG - Intergenic
1035303527 7:157915360-157915382 CTGTCCAGGCAGCATGCAGTGGG + Intronic
1035695362 8:1591746-1591768 CTGGAGATCCAGGATGCAGTTGG - Intronic
1036594407 8:10199391-10199413 CGGGAGGTGCAGGTTGCAGTGGG - Intronic
1037582422 8:20253468-20253490 CTGGAGGGGCGGGGTGCAGCTGG + Exonic
1038447018 8:27611405-27611427 CTGGCAGGGCAGCCTGCTGTCGG - Intronic
1040386487 8:46918091-46918113 CTGGCGGGGCAGGGTCCACCCGG - Intergenic
1042878562 8:73462467-73462489 CAGGAGGGGGAGGTTGCAGTGGG - Intronic
1045232469 8:100317732-100317754 CTAGAGTGGCAGGATGCACTGGG + Intronic
1047238022 8:123059734-123059756 CTGGAGGTGGAGGTTGCAGTGGG - Intronic
1048874593 8:138827136-138827158 CTGGCTGAGGAGGATGCAGCAGG - Intronic
1049365708 8:142235902-142235924 ATGGCGGGGCAGGAGGAGGTGGG + Intronic
1049661178 8:143820322-143820344 CTGACGGGGCTGGAGGCCGTGGG + Intronic
1049708211 8:144052391-144052413 CTGGGTGGGCAGGCTGGAGTAGG - Intronic
1049816551 8:144605777-144605799 CTGGCTGGGCAGGATGACGATGG + Intronic
1050096250 9:2069929-2069951 CTGGGGGGGAAGGAGGGAGTGGG - Intronic
1050303015 9:4277938-4277960 CAGGCAGGACAGGGTGCAGTTGG - Intronic
1051218617 9:14825412-14825434 CTGGAGGAGGAGGTTGCAGTGGG + Intronic
1052313279 9:27091515-27091537 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
1052466664 9:28838781-28838803 TTGGCGGGGCAGGCTACACTTGG + Intergenic
1053134808 9:35643909-35643931 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
1056457272 9:86772449-86772471 AAGGCAGAGCAGGATGCAGTGGG + Intergenic
1057577539 9:96255461-96255483 CTGGAGGTGGAGGTTGCAGTGGG - Intronic
1057883928 9:98814420-98814442 CAGGAGGGGCTGGGTGCAGTGGG + Intronic
1060182908 9:121546193-121546215 CAGGCGGGGCGGGAAGCAGGAGG + Intergenic
1060863703 9:126977953-126977975 CTGGCAGGGCTGGGAGCAGTTGG + Intronic
1061161005 9:128893950-128893972 CGGGAGGCGCAGGTTGCAGTGGG - Intronic
1061234595 9:129335060-129335082 CTGGCCGGGCAGTGGGCAGTGGG - Intergenic
1061685272 9:132271489-132271511 CAGGAGGTGGAGGATGCAGTGGG + Intronic
1061889228 9:133608965-133608987 CAGCCGGGGCAGGCTGCAGTGGG + Intergenic
1062021194 9:134320125-134320147 CTGGCAGGGCAGGATCTGGTGGG + Intronic
1062165347 9:135104808-135104830 CTGGAGGAGCAGGAGGCAGGAGG - Intronic
1062368907 9:136226479-136226501 CTGGCCGTGCAGGCTGCAGGGGG + Intronic
1062452650 9:136621994-136622016 CTGCCGGGGCAGGATGCTCGAGG + Intergenic
1187050140 X:15687645-15687667 GTGGTGGGGCAAGATGCAGAGGG + Intergenic
1187781294 X:22828586-22828608 CGGGAGGGGGAGGTTGCAGTGGG + Intergenic
1188566985 X:31537779-31537801 CTGGCTTGGCAGGATGCAGAAGG - Intronic
1189068511 X:37837611-37837633 CTGGAGGTGGAGGTTGCAGTGGG - Intronic
1189832695 X:44990474-44990496 CTGGAGGTGGAGGATGCAGTGGG + Intronic
1190242285 X:48666774-48666796 CTGAAGAGGCAGGAAGCAGTTGG - Intergenic
1190877917 X:54472650-54472672 CTGGCTGGGCAGGGGGCTGTGGG + Intronic
1192810996 X:74547355-74547377 TTGGCTGGGCAGGAAGCAGCAGG - Intergenic
1195289106 X:103414396-103414418 CAGTCGGGGGAGGATGCAGGTGG + Intergenic
1195728161 X:107938238-107938260 GTGGTGGAGCAGGGTGCAGTTGG - Intergenic
1196823331 X:119721248-119721270 CTGGAGGTGGAGGTTGCAGTGGG + Intergenic
1201233032 Y:11884011-11884033 CTGGCAGGGAATGAGGCAGTTGG - Intergenic
1201233038 Y:11884067-11884089 CTGGCAGGGAATGAGGCAGTTGG - Intergenic
1201511071 Y:14763789-14763811 CTGGCTGGACAGGATGGATTGGG - Intronic