ID: 1034425654

View in Genome Browser
Species Human (GRCh38)
Location 7:151012805-151012827
Sequence GAACACCTTGTAGCATCCTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034425654_1034425655 -10 Left 1034425654 7:151012805-151012827 CCTAAGGATGCTACAAGGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1034425655 7:151012818-151012840 CAAGGTGTTCATATTGAGCATGG 0: 1
1: 1
2: 1
3: 8
4: 139
1034425654_1034425657 -8 Left 1034425654 7:151012805-151012827 CCTAAGGATGCTACAAGGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1034425657 7:151012820-151012842 AGGTGTTCATATTGAGCATGGGG 0: 1
1: 0
2: 1
3: 3
4: 130
1034425654_1034425659 1 Left 1034425654 7:151012805-151012827 CCTAAGGATGCTACAAGGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1034425659 7:151012829-151012851 TATTGAGCATGGGGTGCCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 95
1034425654_1034425664 26 Left 1034425654 7:151012805-151012827 CCTAAGGATGCTACAAGGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1034425664 7:151012854-151012876 GTCTGTCAATCAAAAGAAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 202
1034425654_1034425663 25 Left 1034425654 7:151012805-151012827 CCTAAGGATGCTACAAGGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1034425663 7:151012853-151012875 GGTCTGTCAATCAAAAGAAGAGG 0: 1
1: 0
2: 2
3: 9
4: 109
1034425654_1034425656 -9 Left 1034425654 7:151012805-151012827 CCTAAGGATGCTACAAGGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1034425656 7:151012819-151012841 AAGGTGTTCATATTGAGCATGGG 0: 1
1: 0
2: 0
3: 11
4: 114
1034425654_1034425660 4 Left 1034425654 7:151012805-151012827 CCTAAGGATGCTACAAGGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1034425660 7:151012832-151012854 TGAGCATGGGGTGCCCAGGGTGG 0: 1
1: 0
2: 3
3: 39
4: 344
1034425654_1034425658 0 Left 1034425654 7:151012805-151012827 CCTAAGGATGCTACAAGGTGTTC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1034425658 7:151012828-151012850 ATATTGAGCATGGGGTGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034425654 Original CRISPR GAACACCTTGTAGCATCCTT AGG (reversed) Exonic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
920115310 1:203616639-203616661 GAAGACTTTGTAGCCTCCCTGGG - Intergenic
1069955199 10:72046046-72046068 GAACACCTGGCAGCCTCCCTCGG + Intergenic
1070590886 10:77800229-77800251 GAACAGCTTGCAGCATCCCTTGG + Intronic
1083126574 11:60573716-60573738 GAACATCTGGTAGAATTCTTTGG - Intergenic
1087217248 11:95507275-95507297 GAACACGTTTTGTCATCCTTTGG + Intergenic
1088331399 11:108656626-108656648 GTTCACCTTTTAGCATCTTTAGG + Intergenic
1093990541 12:25585252-25585274 AAAAACCTGGCAGCATCCTTGGG + Intronic
1095721064 12:45401419-45401441 GAACAACTAGTAGCATACTCTGG - Intronic
1103890513 12:124235268-124235290 GAACCACTTGTGGCACCCTTAGG - Intronic
1109501416 13:63240746-63240768 TAAAACCTAGTAGCATCCCTGGG + Intergenic
1110962800 13:81651256-81651278 GAATAACTTGTAGTTTCCTTGGG + Intergenic
1113050660 13:106207873-106207895 GAAAAACTTGTAAAATCCTTTGG - Intergenic
1119909216 14:78334493-78334515 GATCATCTTGTATCATCCTCGGG - Intronic
1128060552 15:64732840-64732862 GACTACCTTGTAGCAGCCTATGG + Intergenic
1139225571 16:65230923-65230945 GTACACCTTGTAGCATTCTGAGG + Intergenic
1139230242 16:65276355-65276377 GTACACCTTGTAGCATTCTGAGG + Intergenic
1140791482 16:78395829-78395851 GAAAACTGTGAAGCATCCTTGGG - Intronic
1141759125 16:86015715-86015737 GAACTCCTTGTATCAGCCGTGGG + Intergenic
1142846379 17:2680299-2680321 GAACACTTTGTTACCTCCTTGGG + Exonic
1146598243 17:34187889-34187911 GTACACCTTGTAGCATTCTGAGG - Intergenic
1147467679 17:40623543-40623565 GACCACCATGTGGGATCCTTGGG + Intergenic
1151842381 17:76627438-76627460 GAACACTTTGCACCACCCTTTGG - Exonic
1152670411 17:81600976-81600998 GAACACCTTTTCCCTTCCTTAGG - Intronic
1157009008 18:43623913-43623935 GAACACTTGGTATCATCCTTTGG - Intergenic
1167479462 19:49720777-49720799 GAAAACCCTGGAGCATCCTGAGG - Intergenic
933006401 2:77001044-77001066 GAACACATTTTTGTATCCTTTGG - Intronic
935055688 2:99564622-99564644 AAACACCAAGTAGCATCTTTGGG + Intronic
936741455 2:115515911-115515933 GAACACCTTCTTCCAGCCTTAGG + Intronic
937755153 2:125528144-125528166 GACCAGCTTTTAGCATCATTGGG - Intergenic
1170157998 20:13285973-13285995 GAACACCATTTGGCATCATTGGG + Intronic
1172815939 20:37686139-37686161 TAACACCTGTTAGCATCCTGTGG - Intergenic
1174772986 20:53318615-53318637 GAACACAATGTAGCTTCCCTGGG + Intronic
1178247177 21:30964623-30964645 GCACACCCAGCAGCATCCTTGGG + Intergenic
1180601299 22:17019136-17019158 CACCACTTTGTAGCATTCTTTGG + Intergenic
953878960 3:46681786-46681808 GAGCACCTTGGAGCACCTTTTGG + Intronic
955964663 3:64376394-64376416 GAGCACCTTGTAGTATATTTTGG - Intronic
956854167 3:73259566-73259588 AAATCCCTTCTAGCATCCTTTGG + Intergenic
959155530 3:102662488-102662510 GAACACTTAGTAGCATACGTGGG - Intergenic
959615859 3:108346376-108346398 AAACTCTTTGTAGCATCCTGGGG - Intronic
960843668 3:121986647-121986669 TAACACCCTTTAGAATCCTTTGG + Intergenic
965713757 3:171581035-171581057 GTACACCTTGTAGCATTCTGAGG - Intergenic
967880025 3:194295264-194295286 GAACACCTTTTAACAGTCTTGGG - Intergenic
969055141 4:4396933-4396955 GAGCATCTTGTAGGATCCTGGGG + Intronic
983414409 4:167437121-167437143 ATACACCTTGTAGCATTCTGAGG + Intergenic
986400485 5:7374502-7374524 AAACACCTGGTAACAGCCTTCGG - Intergenic
986720366 5:10556790-10556812 GAAACCCTTGTGGGATCCTTGGG + Intergenic
995956749 5:117785757-117785779 GAATATCTAGTAGCATCCGTGGG + Intergenic
996836576 5:127800352-127800374 GAATACCTCTTAGCATCCTATGG - Intergenic
1002185214 5:177451360-177451382 GAGCACCCTGTAGCCTGCTTCGG + Intronic
1002185226 5:177451414-177451436 GAGCACCCTGTAGCCTGCTTCGG + Intronic
1002185238 5:177451468-177451490 GAGCACCCTGTAGCCTGCTTCGG + Intronic
1002185250 5:177451522-177451544 GAGCACCCTGTAGCCTGCTTCGG + Intronic
1002185262 5:177451576-177451598 GAGCACCCTGTAGCCTGCTTCGG + Intronic
1002185274 5:177451630-177451652 GAGCACCCTGTAGCCTGCTTCGG + Intronic
1002185286 5:177451684-177451706 GAGCACCCTGTAGCCTGCTTCGG + Intronic
1002185298 5:177451739-177451761 GAGCACCCTGTAGCCTGCTTCGG + Intronic
1004576449 6:16900345-16900367 GAAAACCTTGAAGCAACCTGTGG + Intergenic
1011816554 6:91198142-91198164 GAACACCTGTTAGTCTCCTTGGG - Intergenic
1016113053 6:140249950-140249972 GAAGACCTTCTAGCTTCCTCGGG + Intergenic
1019446266 7:1073212-1073234 GAACACCTTACACCCTCCTTCGG + Intronic
1030261596 7:107570615-107570637 GAGCACCTTGTTACAGCCTTTGG + Intronic
1033447578 7:141436372-141436394 GAACAGCCTGGAGGATCCTTGGG - Intronic
1034425654 7:151012805-151012827 GAACACCTTGTAGCATCCTTAGG - Exonic
1036259894 8:7231189-7231211 GAACATCTTGTAGCCTGATTGGG - Intergenic
1036306721 8:7608333-7608355 GAACATCTTGTAGCCTGATTGGG + Intergenic
1036311937 8:7689758-7689780 GAACATCTTGTAGCCTGATTGGG - Intergenic
1039093155 8:33854588-33854610 GAAGACCTTATATCATCCTCTGG + Intergenic
1040450337 8:47539770-47539792 CAACACCTGATAGCATCCCTTGG - Intronic
1051424341 9:16918507-16918529 AAATACCTTGTAGTATCCTTAGG - Intergenic
1052555951 9:30017703-30017725 GGACACCTTGTGCCATACTTTGG + Intergenic
1054776903 9:69131559-69131581 GAACACCTTGGGGCAGGCTTTGG - Intronic
1057698504 9:97345275-97345297 AAACTCCTTGTAGTATCTTTCGG - Intronic
1186816720 X:13245392-13245414 GAACACCTTGGCCCATGCTTAGG + Intergenic
1188635196 X:32421278-32421300 GAAAACCTTGTAATAACCTTAGG - Intronic
1191564580 X:62509497-62509519 GAACACCTTGAGGAATTCTTTGG - Intergenic
1191669253 X:63733986-63734008 GATCACCTTTTAACTTCCTTTGG - Intronic
1191939268 X:66460157-66460179 GAAAATCTTGGAGCATGCTTTGG + Intergenic