ID: 1034427310

View in Genome Browser
Species Human (GRCh38)
Location 7:151020844-151020866
Sequence GGGTTGGGCTTCGGAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034427310 Original CRISPR GGGTTGGGCTTCGGAAGGGC AGG (reversed) Intronic
900127643 1:1075566-1075588 GACTTGGGCTCAGGAAGGGCCGG + Intergenic
900163371 1:1235108-1235130 AGGCTGGGCCTCGGGAGGGCTGG + Intergenic
900322101 1:2089949-2089971 GAGCTGGGTTTCGGCAGGGCTGG + Intronic
901146318 1:7067152-7067174 GTGTTGGGAATTGGAAGGGCAGG + Intronic
901678017 1:10898203-10898225 GGCTGGGGATGCGGAAGGGCAGG - Intergenic
901792412 1:11661331-11661353 GGGCTGGGCTTGGGAAGGGGAGG + Exonic
901844016 1:11970998-11971020 GGGATGGGGTTGGGAAGAGCAGG + Intronic
902363199 1:15953502-15953524 CGGGTGGGATTTGGAAGGGCTGG + Intronic
903760419 1:25694136-25694158 GGGTTTGGCTGGGTAAGGGCTGG + Intronic
904080951 1:27872419-27872441 GGGCGGGGCTTCGGCGGGGCGGG + Intergenic
904839603 1:33363944-33363966 AGGTTGGGCTTTGGAGGGGAAGG - Intronic
904875350 1:33650546-33650568 GGGGTGGGCTTAGGATGGGGTGG + Intronic
904964386 1:34360425-34360447 GGGTTGGGATGGGGAGGGGCAGG + Intergenic
905201605 1:36320383-36320405 GGGTGGGGCTTCTCAAGGGCAGG - Exonic
906515932 1:46438783-46438805 AGGGAGGGCTTTGGAAGGGCAGG + Intergenic
906769656 1:48472325-48472347 GGGCGGGGCTTCCGAAGGGGCGG + Intergenic
909443651 1:75724636-75724658 CGGTTGGGCTGCGGAAGGACGGG - Intronic
910084330 1:83381538-83381560 GGCTTGGGATTAGGAAGGGCTGG + Intergenic
911399181 1:97353312-97353334 GGGCAGGGCTGCGGAATGGCAGG + Intronic
912421538 1:109545388-109545410 AGGTTGGGCATGGGAAGGGTGGG + Exonic
912452257 1:109774297-109774319 GGGTGGGGCGTCAGGAGGGCTGG + Intronic
912838418 1:113017388-113017410 GAGTTAGGCTTCTGAAGTGCTGG - Intergenic
915627228 1:157122337-157122359 GGGTTGGGGTTGGGAGGGGAGGG - Exonic
916786912 1:168093015-168093037 GGGTCGGCCAGCGGAAGGGCAGG + Intronic
922452334 1:225747085-225747107 GAGCTGGGCTTCTGAAGGGGAGG + Intergenic
923147716 1:231209707-231209729 GGCTTGAGCCTCGGCAGGGCCGG + Intronic
923827099 1:237512621-237512643 GCCTTGGCCTTCCGAAGGGCTGG - Intronic
924940552 1:248810374-248810396 GGGTTGGGCAAGGGAAGAGCAGG - Intergenic
1063116524 10:3075651-3075673 GCCTTGGGCTCCTGAAGGGCTGG - Intronic
1063123757 10:3122964-3122986 GTGTTGTGCTTCGGAAGCCCTGG + Intronic
1064254423 10:13732036-13732058 GGGCTGTGCTTCTGAAGGCCAGG + Intronic
1064567770 10:16660201-16660223 GGCTTGGGCTTCCGAAGCTCAGG + Intronic
1066590536 10:36989392-36989414 GGGTGGGGCTTGGGCATGGCGGG + Intergenic
1067084108 10:43229230-43229252 GGGGAGGGCTGCGGAAGCGCGGG - Intronic
1067121729 10:43478168-43478190 GGGTTGGTCTCCCGAAGTGCTGG - Intronic
1069680038 10:70277742-70277764 GGGTTGGGCTGGGGTGGGGCTGG + Intronic
1073147385 10:101289747-101289769 GGGCTGAGCTTCTGAAAGGCAGG - Intergenic
1073490804 10:103852171-103852193 GGGGTGGGGTTGAGAAGGGCAGG - Intronic
1076348435 10:129796946-129796968 GGGTGGGATGTCGGAAGGGCAGG + Intergenic
1077551963 11:3204402-3204424 GGGTGGGGGTGCGGGAGGGCAGG + Intergenic
1077663921 11:4091890-4091912 GAGTGGGGCATGGGAAGGGCTGG + Exonic
1078452291 11:11449322-11449344 GGGGTGGGCTTGGGAATTGCAGG - Intronic
1079091394 11:17482777-17482799 GGGATGGGCTTAGGCAGGGGTGG + Intergenic
1079250040 11:18780551-18780573 GAGGTGGGCCTTGGAAGGGCTGG - Intronic
1080571851 11:33564116-33564138 GGTTAGTGCTTGGGAAGGGCTGG + Intronic
1081573792 11:44307160-44307182 GGGTGGGGGTTGGGAGGGGCAGG + Intronic
1083428651 11:62602404-62602426 GGATTGGGCCAGGGAAGGGCAGG + Exonic
1083678849 11:64342226-64342248 GGGTCAGGCCTGGGAAGGGCTGG + Intronic
1085417729 11:76330341-76330363 GGCTAGGGCTGTGGAAGGGCAGG + Intergenic
1090202179 11:124864967-124864989 GGGTTTGGCGACGGAAGGGCAGG - Intergenic
1090203312 11:124871000-124871022 GGGGTGGGACTGGGAAGGGCAGG - Exonic
1091285767 11:134408100-134408122 GGGTTGGGATAAGGAAGGGTGGG + Intronic
1091328572 11:134712612-134712634 GGGCGGGGCTGCGGAAGGGCGGG - Intergenic
1091906925 12:4196826-4196848 GGGATGGGGCTGGGAAGGGCTGG - Intergenic
1092910667 12:13142237-13142259 GCTGTGAGCTTCGGAAGGGCAGG - Intronic
1093140835 12:15508797-15508819 AGGTTGTGCTTAGGAAGGACCGG - Intronic
1102182576 12:110923607-110923629 GGGTGGGGATTAGGATGGGCTGG + Intergenic
1102890270 12:116553124-116553146 GGGTAGGGCTTGGGGAGGACAGG + Intergenic
1103414792 12:120736915-120736937 GGTTTGGGCTTGGGGAGGGTGGG + Intronic
1104518164 12:129447063-129447085 GGTTTGGGCTGGTGAAGGGCAGG - Intronic
1104944738 12:132410522-132410544 GGGTGGGGCCTCTGCAGGGCCGG + Intergenic
1112243025 13:97701372-97701394 GGGTTGGGATTCAGAAGGAGGGG - Intergenic
1113386897 13:109857319-109857341 GGGTTGGGTTTCTGAAAGGAGGG + Intergenic
1113415540 13:110125726-110125748 GTTTAGGGCTTGGGAAGGGCTGG - Intergenic
1113844410 13:113378039-113378061 GGTTTGGGCTTTTGGAGGGCAGG + Intergenic
1114145694 14:19975009-19975031 GGGAGGGGCTTCTGAAGTGCTGG - Intergenic
1118246265 14:64114155-64114177 GGGTTTTGCTTGGGAGGGGCAGG + Intronic
1118739752 14:68731066-68731088 GGCTTGGGCTTCCAAAGGCCTGG - Intergenic
1121640146 14:95479826-95479848 GGGTTAGGCATTGGAAGGGGCGG + Intergenic
1122435012 14:101689340-101689362 GGGTGGGGCTTGGGCATGGCCGG - Intergenic
1122791443 14:104185665-104185687 GGGTTGGGGTACGGATGGGGTGG + Intergenic
1123059026 14:105586090-105586112 TAGTTGGGCTTAGGAAGGGATGG + Intergenic
1123083356 14:105706321-105706343 TAGTTGGGCTTAGGAAGGGATGG + Intergenic
1128096388 15:64959652-64959674 GGGTTGGCCTTCCAAAGTGCTGG + Intergenic
1128466275 15:67915151-67915173 GGGTGGGGCTTCTGAGAGGCTGG - Intergenic
1129464060 15:75713877-75713899 GGGTTGGGCTGGAGATGGGCTGG - Intergenic
1129519200 15:76175493-76175515 GGCTTGGACTAGGGAAGGGCGGG - Intronic
1129827638 15:78645080-78645102 GGTGTGGGCTTCGGATTGGCTGG - Intronic
1129930209 15:79404276-79404298 TGGTTGGTCTTCTTAAGGGCTGG + Intronic
1130010963 15:80152782-80152804 GGGCGGGGCTCTGGAAGGGCGGG + Exonic
1130824285 15:87527918-87527940 GGGTCTGGCTTTGGAAGAGCAGG + Intergenic
1132515543 16:364181-364203 GGGGTGGGCATAGGGAGGGCAGG + Intergenic
1132515569 16:364232-364254 GGGGTGGGCGTGGGGAGGGCGGG + Intergenic
1132698467 16:1212273-1212295 GGGCTGGGCCTTGGAGGGGCTGG + Intronic
1133056495 16:3147942-3147964 GGCCTGGGCTTGGGCAGGGCTGG + Intronic
1133258523 16:4533701-4533723 GGGGTGGGCTTGGGAAGGGTGGG - Intronic
1133323821 16:4931396-4931418 AGGTTGGGGTAGGGAAGGGCAGG + Intronic
1134630315 16:15751531-15751553 GGGTTGGGCTTGGCATGTGCAGG - Intronic
1135435045 16:22420989-22421011 TGGCTGGGCTTGGGAGGGGCTGG + Intronic
1136248031 16:28986235-28986257 GGGCTGAGCTTTGGAGGGGCAGG - Intronic
1139364862 16:66427117-66427139 GGGCGGGGCTGCGGCAGGGCAGG + Intergenic
1139491532 16:67288630-67288652 AGCTTGGGCTGGGGAAGGGCTGG - Intronic
1139917826 16:70439101-70439123 GGGTTGGGCCAGGCAAGGGCGGG - Intronic
1139956800 16:70697092-70697114 GGGTTGAGCCTCTGAGGGGCAGG - Intronic
1140512780 16:75520039-75520061 GCCTTGGGCTTCCGAAGTGCTGG + Intergenic
1141317502 16:82976214-82976236 GGCCTGGGCTTTTGAAGGGCTGG + Intronic
1141546411 16:84772728-84772750 GGGTTGAGCTTCTGATGTGCAGG - Intronic
1142044230 16:87914764-87914786 CGGCTGGGCTTGGGAGGGGCTGG + Intronic
1142194243 16:88732279-88732301 GGCTTGGCCTTCGGGAGGGAGGG - Intronic
1144833524 17:18144670-18144692 GGGTTGGGCTTGGGGAGGGCTGG - Intronic
1144872894 17:18381524-18381546 GAGTGGGGCTGCGGCAGGGCTGG + Intronic
1145090082 17:19978644-19978666 GGGTTGGGGTTGGGGAGGGCAGG + Intergenic
1147741957 17:42675019-42675041 TGCTGGGGCTTAGGAAGGGCGGG + Intronic
1148238164 17:45983135-45983157 GTGGCGGGCTTCGGAAAGGCCGG - Intronic
1150358269 17:64506550-64506572 GGGCTGGGCTTGGGAAAGGGCGG - Intronic
1150573821 17:66412304-66412326 GGCTTGGCCTTCTGAAGTGCTGG + Intronic
1151723348 17:75870746-75870768 GGGGTGGGCTGGGGAAAGGCTGG - Intergenic
1151954704 17:77374479-77374501 GGGCAGGGCTTCTGAGGGGCGGG + Intronic
1151983133 17:77526147-77526169 GGGTGGGGCTCGGGCAGGGCGGG + Intergenic
1152016721 17:77755875-77755897 GGGCTGAGCTAAGGAAGGGCTGG - Intergenic
1154370421 18:13756426-13756448 GGGGTGGGATTTGGCAGGGCTGG + Intronic
1156007839 18:32464524-32464546 AGATTGGGCTTCGGAGGGACTGG - Intronic
1159170286 18:64757333-64757355 GCCTTGGGCTTCGAAAGTGCTGG - Intergenic
1160835255 19:1121983-1122005 GGGTGGGGCTGGGGAAGGGCTGG - Intronic
1161153429 19:2721029-2721051 GGGGTGGGCCTCGGTGGGGCGGG + Intronic
1161234191 19:3189896-3189918 GGGCGGGGCTTCGGAATGGGAGG + Intronic
1162573814 19:11487235-11487257 TGGTTGGGCCTGGGAGGGGCCGG - Intronic
1162750482 19:12826322-12826344 AGGTTGGGCTAGGGAAGGGTGGG + Intronic
1162915606 19:13873013-13873035 GGGTTGGGCTTCGTGGGGGCAGG + Intronic
1163700697 19:18785289-18785311 GGGGCGGGCTCGGGAAGGGCGGG - Intronic
1164566106 19:29327235-29327257 GAGTTGGGCTTTTCAAGGGCAGG - Intergenic
1165925001 19:39321092-39321114 GGGTGGGGCTGGGGAAGGGTCGG - Intergenic
1165959487 19:39522393-39522415 GCCTTGGCCTTCGGAAGTGCTGG + Intergenic
1167006171 19:46777736-46777758 GGGTGGGACTTCGGCTGGGCAGG - Intronic
1167108959 19:47447675-47447697 TGGTTGGGCCTCGGGAGGGGAGG - Intronic
1167350243 19:48969713-48969735 GGGCTGGGCTTCGGTGGGGTGGG - Intronic
1167373864 19:49101052-49101074 GGGATGCGCTTCGGCAGGGCTGG - Intronic
1168468094 19:56620170-56620192 GGGCTGGGGTGCGGGAGGGCTGG + Intronic
1168542324 19:57223407-57223429 GGGTAGGGCTGTGGAATGGCTGG + Intergenic
1168590120 19:57626555-57626577 GCCTTGGCCTTCCGAAGGGCTGG - Intergenic
924959278 2:19165-19187 GAGTTTGGCTGCGGGAGGGCAGG - Intergenic
925130082 2:1488498-1488520 GGGTGGGGCCTGGGAAAGGCAGG - Intronic
925427940 2:3766412-3766434 GGGTTGGGATTCTGAAAGTCTGG - Intronic
926458950 2:13103690-13103712 GGGATGGGGTGGGGAAGGGCAGG - Intergenic
927013211 2:18928047-18928069 GGGGTGGGCCTGTGAAGGGCAGG - Intergenic
927492235 2:23528307-23528329 GGTTTGGGGCTCGGAATGGCTGG + Intronic
927862977 2:26571494-26571516 GGATTGGGCTTGGGGAAGGCAGG + Intronic
928203238 2:29264886-29264908 GGGTTGGGCTTCTGAGGAGCTGG + Intronic
928290912 2:30036644-30036666 GGGTTTGGCTTCAGAAGGTCTGG - Intergenic
930837081 2:55805827-55805849 CAGTTGGGCTTTGGCAGGGCAGG - Intergenic
931291912 2:60881307-60881329 GGGGTGGGCTTCGGGAGCGCAGG - Intergenic
931815471 2:65896495-65896517 AGGTTGTCCTTAGGAAGGGCTGG + Intergenic
933675657 2:85054580-85054602 GTTTTGGGGTTTGGAAGGGCCGG + Exonic
934942449 2:98512369-98512391 GGTTTAGTCTGCGGAAGGGCAGG + Intronic
936597541 2:113863208-113863230 GGGTTGGGGGTGGGAAGGACTGG - Intergenic
938193069 2:129300388-129300410 GAGATGGGCTTTGGCAGGGCGGG + Intergenic
939521189 2:143232634-143232656 GGTTGGGGCTTCTGAAGGGCTGG - Intronic
940693945 2:156955914-156955936 GGGTAGGAGTTCTGAAGGGCAGG + Intergenic
941728747 2:168892195-168892217 GGGTTGGGTTTCTGCAGGGTGGG + Intronic
942358374 2:175144685-175144707 GGGTTGGGCTGGGAAAGGGGTGG + Intronic
942748861 2:179265173-179265195 GGGTTGCGGTGAGGAAGGGCTGG + Intergenic
946037104 2:216752844-216752866 GGGTTGGGATGAGGGAGGGCAGG + Intergenic
946139042 2:217672585-217672607 GGGTTGGGCTGTGGATGAGCTGG + Intronic
946142497 2:217703636-217703658 GGGTTGGGCTTGGGAAGAGTTGG + Intronic
946829472 2:223713174-223713196 GTGTTGGTCTTCTGAAGTGCTGG - Intergenic
947641296 2:231709125-231709147 GCGTTGGGAATCGGAAGTGCTGG + Intronic
948013855 2:234671955-234671977 AGGCTGGGCTTAGGCAGGGCAGG - Intergenic
948277868 2:236723897-236723919 GTGTTGGCCTCCTGAAGGGCTGG + Intergenic
948857177 2:240735604-240735626 GGGGTGGGGCCCGGAAGGGCGGG - Intronic
948908108 2:240989446-240989468 GGGTTTGGCTTTGGCTGGGCTGG - Intronic
949034422 2:241810058-241810080 GGGTGGGGCTTCTGAGGGGTGGG + Intronic
1168997758 20:2145617-2145639 GGTTTTGGCTTAGGAAGGGAAGG - Exonic
1171452815 20:25247986-25248008 GGGCGGGGCCTCGGGAGGGCGGG - Intergenic
1173224668 20:41155260-41155282 AGGTTGGGCGTGGTAAGGGCAGG + Intronic
1174353193 20:49982568-49982590 GGGGCGGGCGTCGGAAGGTCAGG + Intergenic
1177963482 21:27698295-27698317 GGGTTGGGCATAGGAAGGCATGG + Intergenic
1178311462 21:31533502-31533524 GGGTTGGCCTTCCTAAGTGCTGG - Intronic
1179632139 21:42685170-42685192 GGGTGGGGCTTCTCCAGGGCTGG - Intronic
1180682526 22:17638518-17638540 GGGTTGGGATTCTGACCGGCTGG - Intronic
1181002720 22:19995389-19995411 GGGGTGGGCTGTGTAAGGGCCGG + Intronic
1182662576 22:31935419-31935441 GGGTTGGGCTTTGGGAGGCCTGG + Intronic
1183105905 22:35614996-35615018 GAGTGGGGCTTCGGAAGGGAGGG - Intronic
1183316345 22:37139078-37139100 GGGTGGGGCTGGGGCAGGGCTGG - Intronic
1183543535 22:38443541-38443563 CGGTTGGGCTTAGGGAGGGCTGG - Intronic
1184885750 22:47343649-47343671 GGGTAGGGATTGGGTAGGGCAGG - Intergenic
1184946960 22:47810696-47810718 CGGTTGGGGTTCTGAAGGGACGG + Intergenic
1185000490 22:48242578-48242600 GGGTTGGGCCCCAGGAGGGCAGG - Intergenic
949866934 3:8554353-8554375 GGGTGGGGCCTCGGCAGGGTGGG + Intronic
950094538 3:10321215-10321237 GGGCTGGGCCACGGGAGGGCGGG - Intergenic
952787713 3:37172472-37172494 GGGTTGGGGTAAGGAAAGGCTGG + Intronic
953200181 3:40771391-40771413 GCTTTGGCCTGCGGAAGGGCTGG - Intergenic
954239859 3:49285073-49285095 GGGCTGGGGGTCAGAAGGGCTGG - Intronic
957328914 3:78734347-78734369 AGGTTGGTCTTCTGTAGGGCTGG - Intronic
961115569 3:124326212-124326234 GGGTTGGGCATGGGCAGGGGAGG + Intronic
961359192 3:126356851-126356873 GGGTTGGGGGGCGGAGGGGCTGG - Intronic
961532498 3:127547878-127547900 GGGCCGGGCTCCGGAAGGGGAGG - Intergenic
961722758 3:128907385-128907407 GGGTTGGGGTTCTCCAGGGCTGG + Intronic
965881686 3:173395782-173395804 GGGGTGGGCTTCGGGGGCGCGGG - Intergenic
968523705 4:1046014-1046036 GGGGTGGGCTCGGGAAGGGCTGG - Intergenic
968523834 4:1046329-1046351 GGGGAGGGCTGGGGAAGGGCTGG - Intergenic
968523947 4:1046636-1046658 GGGAAGGGCTCGGGAAGGGCTGG - Intergenic
968908180 4:3463977-3463999 AGGCTGGGCTGCGGTAGGGCAGG + Intronic
969531689 4:7734071-7734093 GGAATGGGCTGGGGAAGGGCTGG + Intronic
969540952 4:7788379-7788401 GGGCTGGGCTTCAGCAGTGCGGG + Intronic
973844996 4:54902578-54902600 GGTTTGGGCTTTGGAAGGCAGGG - Intergenic
978035345 4:103986160-103986182 GGGTTGGGCTTCCCAAAGACAGG - Intergenic
983533304 4:168832688-168832710 AGGATGGGCTTGGGAAGGGAGGG - Intronic
985552785 5:541772-541794 GGGTGGGGCTGGGGAGGGGCCGG + Intergenic
985624758 5:979569-979591 GTGTTGGGCTTTGCCAGGGCGGG - Intronic
988977843 5:36533070-36533092 GGGTGGAGCTTTGGAAGGTCAGG + Intergenic
989438823 5:41446222-41446244 GGGTTGGGGTTTGGTGGGGCAGG + Intronic
994087289 5:95773247-95773269 GGGCTGGGGTCAGGAAGGGCTGG + Intronic
998764175 5:145466795-145466817 GGGTTGGGGTTAAGAAGGCCTGG - Intergenic
999121886 5:149216067-149216089 GGGGTGAGCTGCGGTAGGGCTGG + Intronic
999231946 5:150066846-150066868 GGGTTGGGGGTCTGAAGGGTTGG - Intronic
999291549 5:150429321-150429343 GGGTTGGTCTCTGGTAGGGCTGG + Intergenic
1001305136 5:170566958-170566980 GATTTAGGCTTCAGAAGGGCAGG + Intronic
1002161064 5:177314394-177314416 GGGTGGGGCTGCAGAGGGGCTGG + Intergenic
1002593536 5:180307073-180307095 GCGTTGGGCTTGGGGAGGGCCGG - Intronic
1003483452 6:6554132-6554154 GGCTTGGGGTTTGGAAGAGCAGG + Intergenic
1004178847 6:13364238-13364260 GGGTTGGGGGTGGGATGGGCTGG - Exonic
1005958206 6:30679261-30679283 GGGTTGGGCTGCTGGAGGGTTGG + Exonic
1006645510 6:35512123-35512145 GGTGTGGGCTGCGGAAGGGAGGG - Intronic
1007696663 6:43737971-43737993 GGGCTGGGCTTGGGAGCGGCGGG + Intergenic
1011762125 6:90578522-90578544 GGGTTGGCCTTCCAAAGTGCTGG + Intronic
1012551842 6:100470187-100470209 GAGTTTGGCTTCAGAAGAGCAGG + Intergenic
1013536297 6:111066151-111066173 GGGTGGGGCTTGGGGAGAGCAGG - Intergenic
1015102009 6:129492448-129492470 GGGGTGGGCGTAGGAAAGGCTGG - Exonic
1018715728 6:166531210-166531232 GGTAAGAGCTTCGGAAGGGCCGG - Exonic
1019168948 6:170117785-170117807 GGCCAGGGCTTCGGAGGGGCTGG - Intergenic
1019300465 7:300592-300614 GGGATGGGAATCTGAAGGGCTGG - Intergenic
1019488138 7:1298896-1298918 GGGTTGGGGCAAGGAAGGGCCGG - Intergenic
1019626369 7:2017915-2017937 GGCCTGGGCTTGGGAAGGGCAGG + Intronic
1022285943 7:28956452-28956474 GGGGTGGGCTCCGCGAGGGCGGG + Exonic
1023859406 7:44208489-44208511 GGGTTTGGCTTCTGAAGACCTGG + Intronic
1024454765 7:49592085-49592107 GAGTAGGGCTTCTGAAGGGCTGG + Intergenic
1026589889 7:71685389-71685411 GGGTTGGACTTTGGAAGAGGCGG - Intronic
1026979519 7:74518233-74518255 CGGCTGGCCTTCGGAAGGCCAGG - Exonic
1027453345 7:78358479-78358501 GGGTGGGCCTTGGGAAGGGTTGG - Intronic
1027774193 7:82443972-82443994 GGGGTGGGCAGCGGGAGGGCTGG + Intergenic
1029469996 7:100748256-100748278 GGGGTGGGCTGGGGGAGGGCTGG + Intronic
1029491778 7:100874756-100874778 GGCGTGGGCTTGGGAAGCGCGGG - Intergenic
1029690127 7:102175658-102175680 TGGGTGGGCCTCGGGAGGGCTGG - Intronic
1034192834 7:149224647-149224669 GGGCTGGGCTGGGGGAGGGCAGG + Exonic
1034427310 7:151020844-151020866 GGGTTGGGCTTCGGAAGGGCAGG - Intronic
1035573344 8:688289-688311 GGGCGGGGCGGCGGAAGGGCCGG - Intronic
1035747393 8:1972284-1972306 GGGTTGGGCCTCCAAAGGCCCGG - Intergenic
1036294982 8:7528383-7528405 GGGTTGGGCTCAGGGAGGCCAGG - Intergenic
1036296612 8:7542978-7543000 GAGTTGGGCTCCAGAAGGCCAGG - Intergenic
1036325954 8:7778041-7778063 GAGTTGGGCTCCAGAAGGCCAGG + Intergenic
1036327582 8:7792608-7792630 GGGTTGGGCTCAGGGAGGCCAGG + Intergenic
1037883125 8:22582434-22582456 GGGTCTGGCAGCGGAAGGGCAGG + Intronic
1039556045 8:38475781-38475803 GGTTTGGGTTCTGGAAGGGCTGG + Intergenic
1040583382 8:48716076-48716098 GGGTGGGGCTTGGGCATGGCGGG + Intronic
1040987303 8:53309906-53309928 GGGTTGGGGAGTGGAAGGGCAGG - Intergenic
1041395906 8:57391005-57391027 GGGTTGTTCTTCTGGAGGGCAGG - Intergenic
1044026955 8:87184468-87184490 GGGTTTGGCGTGGGAAAGGCTGG - Intronic
1045006313 8:97919663-97919685 GGGTGGGGGTTTGGGAGGGCAGG - Intronic
1047229063 8:122980441-122980463 GAGTTGGCCTTAGGAATGGCAGG - Intergenic
1049395537 8:142398429-142398451 GGGTTGTGCTTTGGCAGGGCTGG - Intronic
1049513070 8:143039534-143039556 GGGTCGGGGCTCGGAAGTGCTGG - Exonic
1049569320 8:143361012-143361034 TGGTGGGGCTGGGGAAGGGCTGG + Intergenic
1049588277 8:143441780-143441802 GGGGTGGGCAGAGGAAGGGCAGG - Intronic
1052997918 9:34561056-34561078 GGGTGGGGCGTGGGTAGGGCTGG - Intronic
1053455015 9:38227067-38227089 GGGGGGGGCTCCGGGAGGGCGGG + Intergenic
1053486220 9:38458583-38458605 GGGTTGGGGCACGGAGGGGCAGG - Intergenic
1053612509 9:39729189-39729211 GGGTTGGGGGTCGGGGGGGCAGG + Intergenic
1053870541 9:42487160-42487182 GGGTTGGGGGTCGGGGGGGCAGG + Intergenic
1054555138 9:66647728-66647750 GGGTTGGGGGTCGGGGGGGCAGG - Intergenic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1057045765 9:91885307-91885329 GGGTTGGGGGGCGGTAGGGCAGG + Intronic
1057077239 9:92144390-92144412 GGGTTGGGGATCGGGAGGGAAGG + Intergenic
1057424989 9:94941150-94941172 GGGTTGCCCTTCAGAGGGGCTGG - Intronic
1057429090 9:94978052-94978074 GGGGTTGGCTTTGGGAGGGCTGG - Intronic
1057443364 9:95097493-95097515 GGAGTGGGGTCCGGAAGGGCTGG + Intergenic
1058021927 9:100098898-100098920 GGGTTGGGTTAGGAAAGGGCTGG + Exonic
1060157305 9:121328796-121328818 TGGTTGCGCTTGGGCAGGGCTGG + Intronic
1060485125 9:124041604-124041626 GGGTGGGGCTGCGGTGGGGCTGG + Intergenic
1061149403 9:128820393-128820415 GGGTTGGTAGTTGGAAGGGCTGG + Exonic
1062448289 9:136604874-136604896 GGGTGGGGCTGGGGGAGGGCAGG - Intergenic
1186366510 X:8900270-8900292 TGGTTGGGCTTTGGATGGACTGG - Intergenic
1187200946 X:17133175-17133197 GGCTTGGGCTTCGGAGGAGCAGG + Intronic
1189241978 X:39532322-39532344 GGGTTAGGCTTGGAAATGGCAGG + Intergenic
1190023758 X:46903634-46903656 GGGTTCAGCTTGGGTAGGGCTGG - Intergenic
1192151812 X:68717463-68717485 GGGTGGGGCTGAGGAGGGGCCGG - Exonic
1199815240 X:151391824-151391846 GCGTTGGGCTGCGGGTGGGCGGG + Intergenic
1200148822 X:153941661-153941683 GGGGTGGAGTACGGAAGGGCGGG + Intronic
1200240502 X:154490670-154490692 GGGAGGGGCTTCGGTGGGGCGGG - Exonic
1200355449 X:155545185-155545207 AAGTTGGGCTGTGGAAGGGCCGG + Exonic
1201188815 Y:11429675-11429697 GGGGTGGTCTGCAGAAGGGCAGG + Intergenic