ID: 1034427810

View in Genome Browser
Species Human (GRCh38)
Location 7:151023845-151023867
Sequence GTGTGGGTGTGGGTGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4945
Summary {0: 1, 1: 3, 2: 30, 3: 584, 4: 4327}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034427810_1034427826 14 Left 1034427810 7:151023845-151023867 CCCTCTCCCACCCACACCCACAC 0: 1
1: 3
2: 30
3: 584
4: 4327
Right 1034427826 7:151023882-151023904 CCTTCAGGGACATGAAGCAGGGG 0: 1
1: 0
2: 2
3: 21
4: 257
1034427810_1034427820 0 Left 1034427810 7:151023845-151023867 CCCTCTCCCACCCACACCCACAC 0: 1
1: 3
2: 30
3: 584
4: 4327
Right 1034427820 7:151023868-151023890 ACATACCTCGGAGCCCTTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1034427810_1034427824 13 Left 1034427810 7:151023845-151023867 CCCTCTCCCACCCACACCCACAC 0: 1
1: 3
2: 30
3: 584
4: 4327
Right 1034427824 7:151023881-151023903 CCCTTCAGGGACATGAAGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 219
1034427810_1034427819 -1 Left 1034427810 7:151023845-151023867 CCCTCTCCCACCCACACCCACAC 0: 1
1: 3
2: 30
3: 584
4: 4327
Right 1034427819 7:151023867-151023889 CACATACCTCGGAGCCCTTCAGG 0: 1
1: 0
2: 0
3: 1
4: 59
1034427810_1034427822 12 Left 1034427810 7:151023845-151023867 CCCTCTCCCACCCACACCCACAC 0: 1
1: 3
2: 30
3: 584
4: 4327
Right 1034427822 7:151023880-151023902 GCCCTTCAGGGACATGAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034427810 Original CRISPR GTGTGGGTGTGGGTGGGAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr