ID: 1034433419

View in Genome Browser
Species Human (GRCh38)
Location 7:151051971-151051993
Sequence CTGTCTCCACAGGTGACATT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034433409_1034433419 29 Left 1034433409 7:151051919-151051941 CCAGGGCTGGGGGGGTGTGGGCA 0: 1
1: 0
2: 5
3: 93
4: 788
Right 1034433419 7:151051971-151051993 CTGTCTCCACAGGTGACATTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
1034433408_1034433419 30 Left 1034433408 7:151051918-151051940 CCCAGGGCTGGGGGGGTGTGGGC 0: 1
1: 0
2: 6
3: 66
4: 716
Right 1034433419 7:151051971-151051993 CTGTCTCCACAGGTGACATTGGG 0: 1
1: 0
2: 1
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034433419 Original CRISPR CTGTCTCCACAGGTGACATT GGG Exonic
900749810 1:4388201-4388223 CTGGCTCAGCAGGTGACCTTGGG + Intergenic
902619127 1:17640265-17640287 CTGGGTCAACAGGTTACATTTGG + Exonic
907250875 1:53138398-53138420 CTGTCTCTAAAAGTGTCATTAGG + Intronic
913391570 1:118319548-118319570 ATGTCAACACAGTTGACATTTGG - Intergenic
914330174 1:146661667-146661689 CTGTCTTAGCAGGGGACATTAGG + Intergenic
915583301 1:156829268-156829290 GTGTCTCAACAGGGGACAGTGGG + Intronic
919978173 1:202626279-202626301 CTGTCTCCAAAGGTGGCAAGAGG + Intronic
920048356 1:203148313-203148335 CCATCTCCACAGGTGAGACTGGG - Intronic
920662033 1:207923316-207923338 CTGACTCCTGAGGTGACATCAGG + Intergenic
921575613 1:216831406-216831428 CTGTCTCCTCAGGCTTCATTTGG - Intronic
923605807 1:235441418-235441440 CTGTTACCAAAGGTGACACTCGG + Intronic
1065145758 10:22766361-22766383 CTGTCTTCAGAGGTCAGATTTGG - Intergenic
1067218267 10:44321856-44321878 CTGTCACCACAAGTGAGATATGG + Intergenic
1067496435 10:46764537-46764559 TTTGCTCCACAGGGGACATTTGG + Intergenic
1067549339 10:47222629-47222651 CTGTCTACACGGGTGGCATGAGG - Intergenic
1067598219 10:47575860-47575882 TTTGCTCCACAGGGGACATTTGG - Intergenic
1068369531 10:56095350-56095372 CAGCCTCCACTGGTGACACTTGG - Intergenic
1068858883 10:61826498-61826520 CTGTCTCCAGAGAGCACATTTGG - Intergenic
1070289217 10:75103883-75103905 CAGTCTCCACAGGTGGGAGTGGG - Intronic
1071729249 10:88231626-88231648 CTGTCCCCAAAGGTCACCTTAGG - Intergenic
1072147324 10:92653349-92653371 CTGCTGCCACAGGGGACATTTGG - Intronic
1073773736 10:106763509-106763531 CTCTCTCCAAAGGTAACTTTCGG + Intronic
1074796905 10:116955864-116955886 CTGTCTGCACACATTACATTAGG + Intronic
1075373706 10:121959935-121959957 CACTCTCCACAGGAGACCTTAGG + Intronic
1076024209 10:127099250-127099272 CTGTCCTCACAGAGGACATTGGG - Intronic
1076082081 10:127591368-127591390 ATGTGTCCACAGTTTACATTAGG - Intergenic
1076174936 10:128361060-128361082 CTGTCTCCACTGGAGAAATGTGG + Intergenic
1076212587 10:128660321-128660343 CTGGCTGCACAGTTGACACTTGG + Intergenic
1077884719 11:6378548-6378570 CTGTCAACACTGGTGACATTGGG + Intergenic
1078543859 11:12232286-12232308 CTTCCTCCAAAGGTGACATGAGG - Intronic
1078678049 11:13444869-13444891 CTGTCTCCATAGATAACTTTTGG - Intronic
1079986460 11:27205356-27205378 CTGTCTTCAAAAGTGACATGAGG + Intergenic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1081600481 11:44489287-44489309 ATGGCTGCACAGGTGACATTTGG - Intergenic
1084143281 11:67248843-67248865 CTGCCTCCACATGACACATTTGG - Intronic
1084508817 11:69588937-69588959 CTCTCTCCAATAGTGACATTGGG - Intergenic
1084572332 11:69967096-69967118 CTGTGCCCTCAGGGGACATTGGG - Intergenic
1086084659 11:82942668-82942690 CTACTTCCACAGCTGACATTGGG + Intronic
1086135464 11:83439640-83439662 CAGTCTCCACAGGTGACACTTGG - Intergenic
1087968160 11:104444955-104444977 CTCTCTGAAAAGGTGACATTTGG - Intergenic
1088145894 11:106677368-106677390 CTGTCACCACACTTGATATTTGG + Intronic
1091254541 11:134172316-134172338 GTGGCTGCACTGGTGACATTGGG - Intronic
1092847761 12:12600134-12600156 CTGTTTCCACAGGTGCCCCTGGG - Intergenic
1093051020 12:14504907-14504929 CTGTCTCCAGAAGTGAGATTTGG + Intronic
1095730372 12:45500170-45500192 CTGACTCCACAGGGAACATGAGG - Intergenic
1096259291 12:50081090-50081112 CTGCCCCCGCAGGTGACATCGGG + Exonic
1096542100 12:52313682-52313704 CCTTCTCCACAGCTGACATGAGG - Intergenic
1097858688 12:64495099-64495121 CTGCCTACACAGTTGATATTTGG + Intronic
1099412920 12:82353611-82353633 CTGTTTCCAAAGGTGACAGATGG + Intronic
1100197983 12:92269159-92269181 CTGTCTCCCCTGGTTACCTTTGG - Intergenic
1100931507 12:99615124-99615146 GTGTTTACACAGATGACATTAGG + Intronic
1101870878 12:108564144-108564166 CTTTCTACTCAGGTGAAATTTGG + Intronic
1102213829 12:111146198-111146220 CAGAGTCCACAGTTGACATTAGG + Intronic
1103602879 12:122065244-122065266 CTCTCTCCACAGGTGGGGTTGGG + Intergenic
1106598417 13:31166606-31166628 CTTTGTCCATTGGTGACATTCGG - Intergenic
1108464240 13:50698304-50698326 CTGTCTGCACAAATGACCTTGGG + Intronic
1108959669 13:56209412-56209434 TTTTCTCCACAGGTTACACTAGG + Intergenic
1116340466 14:43716444-43716466 CAGTCTCCACATCTTACATTAGG + Intergenic
1117235072 14:53765066-53765088 CTCTCTCCACACCTGACATTAGG - Intergenic
1117302813 14:54445187-54445209 CTTTCTCCTCAGGTGAAATAGGG - Intergenic
1117549708 14:56822402-56822424 TTGTCCCCCCAGGGGACATTTGG + Intergenic
1117744765 14:58858249-58858271 ATGTCTTTACAGGTGAGATTAGG + Intergenic
1118586536 14:67359096-67359118 CTCTCACAGCAGGTGACATTTGG + Intronic
1119611694 14:76068755-76068777 CAGTCTCTACAAGTGACTTTGGG + Intronic
1120963143 14:90143242-90143264 CTGTCTCCAGAGCTGAAATGCGG + Intronic
1121455460 14:94035972-94035994 CTGTCTCCACATGGGACAGATGG - Intronic
1121734239 14:96206680-96206702 GTGGCTCCAGAGGTAACATTAGG + Intronic
1124106274 15:26740632-26740654 CTGTCTCCACAGCTGAGGCTTGG + Intronic
1124493800 15:30174219-30174241 CTGTCTCCAAAGGTGGCAAGAGG + Intergenic
1124583636 15:30985429-30985451 CTGGCTGCACTGGTGACACTAGG - Intronic
1124749768 15:32364430-32364452 CTGTCTCCAAAGGTGGCAAGAGG - Intergenic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1128570195 15:68728111-68728133 CTGACACCCCAGGGGACATTGGG - Intergenic
1129799571 15:78403844-78403866 TTCTCCCCACAGGGGACATTTGG + Intergenic
1131549990 15:93349117-93349139 TTGCCTCCAAAGGTGAAATTAGG - Intergenic
1134107863 16:11496756-11496778 CTGTCTCCACACGTCCCACTGGG + Intronic
1134117825 16:11562421-11562443 CTGTCACCACCGGTCACATTTGG - Intronic
1135742142 16:24985069-24985091 CTGTGTCCCCAGAGGACATTTGG + Intronic
1136511123 16:30738827-30738849 TTTTCTCCACAGGTGACAGGAGG - Exonic
1137894715 16:52198945-52198967 CAGAGTCCACAGGTGACATTAGG - Intergenic
1138426984 16:56941332-56941354 CTCTCTCCCCAGGGGACATTTGG + Intronic
1138624051 16:58235225-58235247 CCCTCTCCCCAGGCGACATTTGG - Intronic
1139534940 16:67565946-67565968 CAGTCTCTAGAGGTGACTTTTGG - Intronic
1140003382 16:71049240-71049262 CTGTCTTAGCAGGGGACATTAGG - Intronic
1140833324 16:78770962-78770984 CTCTCTAAAAAGGTGACATTTGG + Intronic
1141439156 16:84018160-84018182 CTGTCTTCAGAGGTGGCATAGGG + Intronic
1142864737 17:2783870-2783892 CTGTCTCCACATGCTAGATTGGG + Intronic
1142997346 17:3768774-3768796 CTGTCTCCCCACGAGACAGTAGG + Intronic
1144802579 17:17940694-17940716 TGGTCTCCACAGCTGTCATTGGG + Intronic
1145875555 17:28316587-28316609 CTCTCTCCTCAGGTGACCTAAGG + Intergenic
1146379858 17:32320622-32320644 CTCTCTAAAGAGGTGACATTTGG - Intronic
1148248925 17:46056963-46056985 TTGTCCTCACAGGAGACATTTGG - Intronic
1148863800 17:50618306-50618328 GAGTCTCCACAGGTGACAATTGG + Exonic
1148905978 17:50912344-50912366 CTGTTTCCACAGGCCACATGTGG - Intergenic
1148935981 17:51165149-51165171 CTGTTTTCACAGTTGACATTTGG + Intronic
1151436165 17:74099173-74099195 CTGGCTCCACAGGGGACACGGGG + Intergenic
1153574783 18:6509584-6509606 CTGTCTCCAGGGGTTACACTCGG - Intergenic
1153929378 18:9865324-9865346 CTGTGACCAGAGGTGACAGTGGG - Intergenic
1157288734 18:46394981-46395003 CTGTCTCCACAGGCTACATGAGG - Intronic
1157388613 18:47281823-47281845 CTGGCTTCAGAGGTGAAATTTGG + Intergenic
1159175814 18:64832063-64832085 CTGTCACCAGGGCTGACATTAGG - Intergenic
1159257213 18:65962513-65962535 CTCTCTAGACAGGTCACATTGGG - Intergenic
1160285610 18:77540061-77540083 CTGTCTCTCCAGATGACATGAGG + Intergenic
1161137188 19:2626708-2626730 CTGTCCCCTCAGGGGACACTGGG + Intronic
1161847072 19:6718236-6718258 CTGGCTCCACAGGTGAGGCTGGG - Exonic
1161860288 19:6792769-6792791 CTGTCCTCCCAGGGGACATTTGG + Intronic
1162433637 19:10643920-10643942 CTGTCTCAACAGCTGAGATGGGG + Exonic
1165949394 19:39465528-39465550 ATGTTTCCCCAGGGGACATTTGG + Intronic
1167446176 19:49538963-49538985 CAGTCTCAACAGGTGGCATGTGG - Intronic
1168504889 19:56925310-56925332 TTGTCTCCCCCGGGGACATTGGG + Intergenic
1168686697 19:58353317-58353339 CTGTCTCCGCAGGTGTCACCTGG - Exonic
925841320 2:7994918-7994940 CAGTTTCCACAGGTAACCTTTGG + Intergenic
929531425 2:42755433-42755455 CTATCTACCCAGTTGACATTTGG + Exonic
932173401 2:69577774-69577796 CTGTCTCCACAGGAGGCAGGAGG + Intronic
933251592 2:80035257-80035279 CTGTCTCCACCGCTTACATCTGG + Intronic
934495301 2:94790783-94790805 CTGTTTAAACAGCTGACATTTGG + Intergenic
936149652 2:110008259-110008281 CTGTCTTCACAGCAGACACTGGG - Intergenic
936195026 2:110363110-110363132 CTGTCTTCACAGCAGACACTGGG + Intergenic
938364773 2:130726335-130726357 CTCTCTCAAAAGGTGACCTTAGG + Intergenic
940090901 2:149915793-149915815 CATTCTCCACAGGTGAGTTTAGG - Intergenic
940211852 2:151262930-151262952 GTGTCCCCACAGGCGCCATTCGG - Intergenic
941347252 2:164385851-164385873 CTTTCTTGACAGGAGACATTTGG - Intergenic
943200465 2:184817219-184817241 CAGTCTCCACTGGTGATATCTGG + Intronic
945370947 2:209017037-209017059 CTGTTAGCAGAGGTGACATTAGG - Intergenic
945447710 2:209957785-209957807 CATTCTCAACAGCTGACATTCGG - Intronic
946101265 2:217326490-217326512 TTGTCCCCTCAGGGGACATTTGG - Intronic
946534619 2:220612811-220612833 CTATCTCCACGGGTGATAGTTGG + Intergenic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1170942156 20:20857277-20857299 GTCTCTGCACTGGTGACATTTGG + Intergenic
1173137222 20:40449109-40449131 CTGTCCCCACTAGTGAAATTTGG - Intergenic
1174253192 20:49234682-49234704 CTCTCTGAAGAGGTGACATTAGG - Intronic
1176242269 20:64080515-64080537 CAGGCCCCACAGGAGACATTCGG - Intronic
1177791309 21:25724919-25724941 ATGTCTCCTCATCTGACATTTGG - Intronic
1177947751 21:27492787-27492809 CTTTCTCCACATGAAACATTAGG + Intergenic
1180583102 22:16860106-16860128 CTGTCTTCACAGCAGACACTGGG + Intergenic
1181902256 22:26166267-26166289 TTATCTCCCCAGGTGGCATTGGG + Intergenic
1181923215 22:26336825-26336847 TTTTCCTCACAGGTGACATTTGG - Intronic
1182441115 22:30364857-30364879 CTGTCACCGCTGGTGACAATAGG + Intronic
1183528560 22:38339084-38339106 CTTTCTACACATGTGACTTTGGG - Intronic
950439200 3:12998786-12998808 CTGTCTCCACAGTTCACCCTCGG - Intronic
950519451 3:13487974-13487996 CTGTGATCACAGGTGACATGTGG + Intronic
950924717 3:16729046-16729068 TTGCCTCCCCAGGGGACATTTGG - Intergenic
951275364 3:20678624-20678646 CTGGCTCCTGAGGGGACATTAGG + Intergenic
951634049 3:24753756-24753778 ACGTCCCCACAGGAGACATTGGG - Intergenic
953874851 3:46660869-46660891 CTGTCCCCAGAGGAGACAGTGGG + Intergenic
955031956 3:55230664-55230686 CTGTGTCCACTGGAGACAGTGGG + Intergenic
955096781 3:55806557-55806579 TTTGCTACACAGGTGACATTTGG + Intronic
956381474 3:68668723-68668745 TTTACTCCCCAGGTGACATTTGG - Intergenic
956680490 3:71774961-71774983 TTGTGTCCCCAGGGGACATTTGG + Intronic
957816636 3:85308623-85308645 CTATTTCCACAGGTGGTATTGGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960316376 3:116183122-116183144 CTGTCTCTAGAGGTCACATATGG - Intronic
961661547 3:128471237-128471259 CTCCCTCCCCAGGGGACATTTGG + Intergenic
961668606 3:128509939-128509961 CTCTCTGCACAGGTGAGGTTGGG - Intergenic
962250129 3:133830961-133830983 CCCTCCCCACAGGGGACATTTGG - Intronic
962671243 3:137710844-137710866 CTGTCACCCCAGGTGACAGAGGG + Intergenic
964422850 3:156522441-156522463 ATCTCTCCAGAGATGACATTTGG - Intronic
967961230 3:194925955-194925977 CTGTCTCCCCAGATCACATGCGG + Intergenic
968684405 4:1947302-1947324 CTCTGGCCACAGGTGACACTTGG + Intronic
970881277 4:20935060-20935082 CTGTGTCCTCAAGGGACATTTGG - Intronic
973576735 4:52297214-52297236 CCCTCTCCCCAAGTGACATTTGG - Intergenic
974562471 4:63539950-63539972 CTGTCTTCACAGCTGTCATTTGG - Intergenic
975525484 4:75344196-75344218 CAGTATCCAAAGATGACATTGGG + Intergenic
979287521 4:118942670-118942692 ATGTTGCCACAGGGGACATTTGG + Intronic
980150690 4:129043781-129043803 CTGTTTCCCCAGGAGATATTTGG - Intronic
981764241 4:148229722-148229744 CTTTGGCCAGAGGTGACATTTGG - Intronic
983552626 4:169032989-169033011 CTGTTTCCACAGGTGTAAATTGG - Intergenic
984193583 4:176633021-176633043 CTTTCACCACAGGTGACTTGAGG + Intergenic
985359659 4:189159115-189159137 CCCTCCCAACAGGTGACATTGGG + Intergenic
986851425 5:11817701-11817723 CTGTCTCCACAGGTTACGGCGGG + Intronic
987163656 5:15171558-15171580 CTGTGTCCCAAGGTGACGTTAGG - Intergenic
991369809 5:65906471-65906493 TTGGCTCCAAAGGGGACATTTGG + Intergenic
991686561 5:69187524-69187546 GTGTCTCCACTGCTCACATTTGG - Intergenic
991949157 5:71931256-71931278 CTGTCTCCAAAGATGAATTTGGG + Intergenic
994077852 5:95673229-95673251 CTGTGTGCACAGGCAACATTTGG + Intronic
994088736 5:95789139-95789161 ATGTGTCCTCAGGTGACATTTGG + Intronic
996652604 5:125898530-125898552 CTCCCTCCACAGGTTACATTAGG + Intergenic
997615799 5:135245462-135245484 CTGTGTCCACAGGTGATAGCAGG - Intronic
999221106 5:149978508-149978530 CTGACTCCACAGGTAATATAAGG + Intronic
999390425 5:151185690-151185712 ATGTCTCAAAAGGTGATATTCGG - Intronic
1001329243 5:170750764-170750786 CTCACTCCACTGGTGACATGGGG - Intergenic
1004169863 6:13287550-13287572 CTGGCTCCAGACATGACATTTGG + Exonic
1005807586 6:29488847-29488869 CCTTCTCCTCAGCTGACATTTGG - Intergenic
1006566881 6:34967252-34967274 CTGTCAACACAGTTCACATTTGG - Exonic
1008039891 6:46786271-46786293 CTGACACACCAGGTGACATTGGG - Intergenic
1013012786 6:106135099-106135121 CTGGCTGAACCGGTGACATTTGG - Intergenic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1017374291 6:153750253-153750275 CTGTCTCCACAGGGCACAAAAGG + Intergenic
1017666212 6:156722360-156722382 CTGGCTGCAGAAGTGACATTTGG + Intergenic
1018488251 6:164264459-164264481 CTGTCTGCCCAGGTGACCTCTGG - Intergenic
1020464805 7:8465346-8465368 CTCTATGCTCAGGTGACATTGGG + Intronic
1020859386 7:13471940-13471962 CAGGCTCCACTGGTGACATTTGG - Intergenic
1023557434 7:41437839-41437861 CTGTCTCCCCTGGTGACTGTTGG + Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1025247417 7:57327819-57327841 TTGCCCCCACAGGGGACATTAGG - Intergenic
1025745745 7:64241314-64241336 CTGTCTCCACAATTGGGATTGGG - Intronic
1026319152 7:69253956-69253978 CTGTATCCACTGCTGTCATTTGG + Intergenic
1026841685 7:73672786-73672808 GTTTCTCCAAAGGTGCCATTTGG - Intergenic
1034433419 7:151051971-151051993 CTGTCTCCACAGGTGACATTGGG + Exonic
1036683650 8:10894026-10894048 CAGTCCCCTCAGATGACATTAGG - Intergenic
1036957701 8:13207685-13207707 CTTTCTCCCTAGGGGACATTTGG + Intronic
1037455159 8:19055763-19055785 CTGTCGCCACAGGTCACAGCAGG - Intronic
1037766043 8:21772931-21772953 CTGCGTGCACAGGTGACACTGGG - Intronic
1039788691 8:40856672-40856694 ATATTTCCCCAGGTGACATTGGG + Intronic
1042670654 8:71259317-71259339 GTGTGTCCACAGGTGACTCTTGG - Intronic
1042967346 8:74368917-74368939 TTTTCTCCCCTGGTGACATTTGG - Intronic
1043000965 8:74759128-74759150 TTTCCTCCACAGGGGACATTTGG + Intronic
1046567463 8:115919485-115919507 CACTCTCCACAGGTGGGATTAGG - Intergenic
1047715460 8:127591032-127591054 CTTGCTCCCCAGGTGACATTTGG + Intergenic
1048286766 8:133147584-133147606 CTGGCTCGCCAGGTGACATCAGG + Intergenic
1049841315 8:144774554-144774576 TTGACTTCACAGGAGACATTTGG - Exonic
1050236836 9:3590604-3590626 CTATTTCCAAACGTGACATTTGG - Intergenic
1055269182 9:74536772-74536794 CTGTCTCACCAGGTGACTGTGGG - Intronic
1055773756 9:79745570-79745592 CTGTCTCCACGGATGAGTTTGGG - Intergenic
1056477315 9:86965213-86965235 CTTTCTACACATCTGACATTTGG - Intergenic
1057063651 9:92027591-92027613 CTGTAACCAAAGGAGACATTAGG + Intergenic
1057261938 9:93589495-93589517 CTGTGTCCCCAGGAGACAGTTGG - Intronic
1057494993 9:95553618-95553640 CTGTCTCTGGAGGTGTCATTTGG + Intergenic
1057563815 9:96150583-96150605 CTGCCCCCCCAGGTGACATTAGG - Intergenic
1058903299 9:109460387-109460409 CTCTGTCCACAGTTGACAATAGG - Intronic
1062133146 9:134911049-134911071 CTGTCTCCCCTGGTGACCTTGGG - Intronic
1186523752 X:10228889-10228911 CCCCCTCCACAGGAGACATTTGG + Intronic
1186646720 X:11514558-11514580 TTGTCTTCTCAGGGGACATTTGG - Intronic
1186659990 X:11659979-11660001 CTTTGTCCCCAGGGGACATTTGG - Intronic
1186803951 X:13120660-13120682 TTTGCTCCACAGGGGACATTTGG - Intergenic
1187033085 X:15508743-15508765 TTTGCTCCCCAGGTGACATTGGG + Intronic
1188173852 X:26963723-26963745 CTGTCTGCACTGTTTACATTAGG - Intergenic
1190234234 X:48603724-48603746 CTGTCCCCACAGGTAACCTGGGG - Intronic
1191109494 X:56793758-56793780 CTGGCTCCACAGCTGTCTTTAGG + Intergenic
1194350194 X:92817819-92817841 CAGTCTCCACTGGTGACACAAGG - Intergenic
1195476864 X:105297086-105297108 CTCTCTGAAGAGGTGACATTTGG + Intronic
1197551851 X:127901363-127901385 CTGTCTTCACAGGTGGCAGATGG + Intergenic
1197666463 X:129229397-129229419 CTAGCTCCATAGGTGACCTTGGG + Intergenic
1197996416 X:132380379-132380401 TTGTTTCCAGAGGTGTCATTTGG - Intronic
1199465749 X:148134634-148134656 CTGTTTATACAGGTGCCATTAGG + Intergenic
1200658514 Y:5934461-5934483 CAGTCTCCACTGGTGACACAAGG - Intergenic
1200660608 Y:5952014-5952036 GTGGGTCCACAGGTGACACTGGG - Intergenic
1200890852 Y:8322539-8322561 CTCTGTCTACTGGTGACATTGGG + Intergenic
1202251894 Y:22881571-22881593 CTCTGTCCAAAGGTGAAATTGGG - Intergenic
1202404882 Y:24515320-24515342 CTCTGTCCAAAGGTGAAATTGGG - Intergenic
1202465897 Y:25154762-25154784 CTCTGTCCAAAGGTGAAATTGGG + Intergenic