ID: 1034434645

View in Genome Browser
Species Human (GRCh38)
Location 7:151057561-151057583
Sequence ATTTCAGGAAGTGTCGCGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034434642_1034434645 5 Left 1034434642 7:151057533-151057555 CCAAGTGCTGCTGAGGCTGGGGT 0: 1
1: 0
2: 6
3: 59
4: 611
Right 1034434645 7:151057561-151057583 ATTTCAGGAAGTGTCGCGGTTGG 0: 1
1: 0
2: 0
3: 9
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034434645 Original CRISPR ATTTCAGGAAGTGTCGCGGT TGG Intronic