ID: 1034434764

View in Genome Browser
Species Human (GRCh38)
Location 7:151058155-151058177
Sequence TGGGAACCACGGCGCCGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034434764_1034434773 30 Left 1034434764 7:151058155-151058177 CCGCCGCGGCGCCGTGGTTCCCA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1034434773 7:151058208-151058230 TGCTCCCAGCCCTCTTGAAAAGG 0: 1
1: 0
2: 1
3: 22
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034434764 Original CRISPR TGGGAACCACGGCGCCGCGG CGG (reversed) Exonic