ID: 1034434764

View in Genome Browser
Species Human (GRCh38)
Location 7:151058155-151058177
Sequence TGGGAACCACGGCGCCGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034434764_1034434773 30 Left 1034434764 7:151058155-151058177 CCGCCGCGGCGCCGTGGTTCCCA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1034434773 7:151058208-151058230 TGCTCCCAGCCCTCTTGAAAAGG 0: 1
1: 0
2: 1
3: 22
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034434764 Original CRISPR TGGGAACCACGGCGCCGCGG CGG (reversed) Exonic
901556063 1:10032616-10032638 TGGGAACAACGGAGGCGCGGCGG + Intergenic
904492412 1:30869265-30869287 AGGAAACCACGGAGCCGCTGCGG - Intergenic
912458085 1:109812300-109812322 TGTGAGCCACGGCGCCGAGCCGG - Intergenic
915934783 1:160084073-160084095 TGGCGGCCGCGGCGCCGCGGCGG - Exonic
920528358 1:206684967-206684989 TGGGGACCGCGGGGCGGCGGGGG - Intronic
921229188 1:213051338-213051360 AGGGAAACCCGGCGCCGCCGCGG - Exonic
921453151 1:215334151-215334173 TGGGAACCACTGCCCCACAGTGG + Intergenic
922199991 1:223393521-223393543 TGGGAACCCCCGCGGCCCGGCGG + Exonic
923522695 1:234748193-234748215 TGGGAAGCACGGGGCCGCTAAGG - Intergenic
1065020220 10:21496577-21496599 TGGGCCCCAGGGCGACGCGGCGG - Intronic
1085291017 11:75399601-75399623 GGAGAACGACGGCGCCGCGCGGG + Intronic
1096647823 12:53047908-53047930 TGGGAGCCCGGCCGCCGCGGAGG - Intronic
1107467870 13:40666044-40666066 TGCCAACCCCGACGCCGCGGCGG - Exonic
1116685751 14:48036139-48036161 TGGGATCCAAGGCGCCGGTGGGG + Intergenic
1116905144 14:50396814-50396836 CGGGACTCACGGCGCCGCGGCGG + Intronic
1122888819 14:104723463-104723485 TGGGAACCTGGGCCCCACGGTGG + Intergenic
1126134628 15:45378405-45378427 CGGGAGCCGCGGCGCCGAGGCGG - Exonic
1127868097 15:63048180-63048202 GGGTCACCACCGCGCCGCGGAGG + Intronic
1128398691 15:67254853-67254875 TGGAAACCGCGCCTCCGCGGAGG + Exonic
1132889540 16:2196905-2196927 TGGGAGCCCCGACGCGGCGGCGG + Intergenic
1135250850 16:20900239-20900261 TGGAAACGACGGCGGCCCGGCGG + Exonic
1136019051 16:27428387-27428409 TGGGAACCCCGGCACAGAGGAGG + Intronic
1137761644 16:50945648-50945670 TGGGAACCATGGCCCTGCTGAGG - Intergenic
1139467094 16:67159845-67159867 TGGGAACCCAGGCCCCGCCGAGG - Exonic
1143174103 17:4946908-4946930 TGAGAACCACCCCGCCGTGGGGG + Intronic
1145077511 17:19867861-19867883 GGGGAAGCGCGGGGCCGCGGCGG - Exonic
1152544114 17:80992177-80992199 CGGCAGCCACGGCGCCGCGCAGG - Intronic
1160394057 18:78559126-78559148 AGGGAGCCACGCCCCCGCGGGGG - Intergenic
1161076556 19:2288595-2288617 TGGGAAGCACGTGGCAGCGGAGG + Intronic
1161590454 19:5127015-5127037 TGGAAACCCCGGCGCTGGGGAGG + Intronic
1165448307 19:35868762-35868784 TGGGAGCCCCGGCGCGGCCGAGG + Exonic
1166121832 19:40691132-40691154 TGGGAACGGGGGCGCCGGGGTGG + Intergenic
1167174006 19:47852972-47852994 TGGGAAGCCGGGCGTCGCGGGGG - Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
934718764 2:96558507-96558529 TGGGAACCACTGGGACGCGGAGG - Intergenic
940847924 2:158661330-158661352 TAGGAACCTCAGCTCCGCGGGGG + Exonic
943725251 2:191245775-191245797 TGGGAGACGCGGCGCTGCGGCGG + Intronic
1172146487 20:32761929-32761951 GGGGCACCGCGGCGCCCCGGTGG + Intergenic
1176018365 20:62950097-62950119 TGGGAACCAGGGAGAAGCGGTGG + Intergenic
1181902675 22:26169311-26169333 TGGCACCCCCGGCGCCGCCGCGG + Intergenic
1184332299 22:43834474-43834496 TGGGAAGCTCAGGGCCGCGGTGG - Intronic
1184569062 22:45310513-45310535 TGGGAACCACGGCTCCCCACAGG - Intronic
1184680922 22:46071731-46071753 CGGGGACGGCGGCGCCGCGGGGG + Intronic
1184776314 22:46625241-46625263 TGGGAACCTCCGCGCCTCTGTGG + Intronic
1185204736 22:49531327-49531349 TGGGGAGCAGGGCACCGCGGAGG + Intronic
950679355 3:14574361-14574383 TGAGCACCGCGGGGCCGCGGCGG - Intergenic
950689712 3:14646279-14646301 TTGGAACCACGGCGGGGCGCAGG - Intergenic
963882683 3:150546233-150546255 TGAGAACCTCGGCGCTCCGGCGG - Exonic
968850506 4:3074659-3074681 TGGGACGCAAGGCGCCGTGGGGG + Exonic
983938041 4:173516804-173516826 TGGCCCCCTCGGCGCCGCGGTGG - Intergenic
984427068 4:179600301-179600323 TGTGAACCACGGCGCCCGGCCGG + Intergenic
1002012468 5:176294679-176294701 TGTGAGCCACGGCGCCGAGCCGG - Intronic
1003185016 6:3822852-3822874 TGGGAGCCACCGCGCCGAGCTGG + Intergenic
1004483253 6:16040663-16040685 TGGGAACCAGGGCTGCGCGTGGG - Intergenic
1015792085 6:136973909-136973931 TGTGAACCACCGCGCCGGGCCGG + Intergenic
1019472915 7:1230594-1230616 TGGGACGCACGGAGCCGCCGCGG + Intergenic
1021231060 7:18086744-18086766 CGGGAGCCCCAGCGCCGCGGAGG - Intergenic
1034434764 7:151058155-151058177 TGGGAACCACGGCGCCGCGGCGG - Exonic
1035557647 8:578738-578760 TGGCAACCACGGAGCCACAGTGG - Intergenic
1042219616 8:66460553-66460575 TGGAAACCAGGGCTCCCCGGTGG + Intronic
1053161793 9:35818577-35818599 TGTGAACCAGGGAGCCCCGGGGG + Intronic
1061806343 9:133139633-133139655 GGGGAACTACGGCCCCGAGGAGG - Intronic
1062024890 9:134335763-134335785 TGGGAGCCAGGGCCCCGAGGTGG - Intronic
1193655020 X:84188085-84188107 TGGGAATCACCGGGCGGCGGCGG - Intergenic