ID: 1034436030

View in Genome Browser
Species Human (GRCh38)
Location 7:151063158-151063180
Sequence GGCCGCTGCTCCGCGCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034436027_1034436030 -8 Left 1034436027 7:151063143-151063165 CCGGCTGTGCCGGCCGGCCGCTG 0: 1
1: 0
2: 2
3: 50
4: 468
Right 1034436030 7:151063158-151063180 GGCCGCTGCTCCGCGCCCGCAGG 0: 1
1: 0
2: 2
3: 21
4: 323
1034436026_1034436030 -4 Left 1034436026 7:151063139-151063161 CCTGCCGGCTGTGCCGGCCGGCC 0: 1
1: 0
2: 1
3: 24
4: 215
Right 1034436030 7:151063158-151063180 GGCCGCTGCTCCGCGCCCGCAGG 0: 1
1: 0
2: 2
3: 21
4: 323
1034436025_1034436030 -3 Left 1034436025 7:151063138-151063160 CCCTGCCGGCTGTGCCGGCCGGC 0: 1
1: 0
2: 2
3: 31
4: 171
Right 1034436030 7:151063158-151063180 GGCCGCTGCTCCGCGCCCGCAGG 0: 1
1: 0
2: 2
3: 21
4: 323
1034436022_1034436030 4 Left 1034436022 7:151063131-151063153 CCGCATTCCCTGCCGGCTGTGCC 0: 1
1: 0
2: 0
3: 28
4: 268
Right 1034436030 7:151063158-151063180 GGCCGCTGCTCCGCGCCCGCAGG 0: 1
1: 0
2: 2
3: 21
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034436030 Original CRISPR GGCCGCTGCTCCGCGCCCGC AGG Intronic
900090559 1:918532-918554 GGCTGCTGCTCCCCGGCCACCGG + Intergenic
901040242 1:6359144-6359166 GGCCGCTGCTGAGCGGCCTCAGG + Intronic
901086002 1:6613102-6613124 GCTCCCTGCTCCGGGCCCGCGGG - Intronic
901086549 1:6614743-6614765 GGCCCCCGCCCCCCGCCCGCGGG + Intronic
901272289 1:7961753-7961775 GGCCGGGGCGCCGCGTCCGCAGG + Intronic
901332774 1:8423739-8423761 GGCCCCAGCCCCGCGCCCCCCGG - Intronic
901796372 1:11681639-11681661 CGCCCCTGCTCCGCCCCCACCGG + Intronic
902478300 1:16699428-16699450 CGCCGCTCCTCCTCGCCCACCGG - Intergenic
902920702 1:19664881-19664903 GGCCTCTCCTCCGCGCGTGCGGG + Intergenic
903263303 1:22142757-22142779 GCCCGCTGCCCCGCGCCGCCTGG + Intronic
903526487 1:23994953-23994975 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
903923432 1:26817459-26817481 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
903925179 1:26826769-26826791 GGCCTCGGCTCCGCGCCCCGCGG - Exonic
904125597 1:28236286-28236308 GTCCGCTGCTCCAGCCCCGCGGG + Intronic
904696745 1:32335616-32335638 GGCCCCAGCTCCGCGGCCCCTGG + Intronic
904794833 1:33051329-33051351 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
904822872 1:33256602-33256624 GGCCGCAGCCCCGCGCCCGGCGG - Exonic
904886033 1:33739110-33739132 GGCCACTGCTCCCAGCCTGCAGG + Intronic
905107664 1:35573934-35573956 GGCAGCTGCTCCCAGCCCGTCGG - Exonic
905995968 1:42380810-42380832 CGCCACGGCTCCGCTCCCGCGGG - Exonic
906191033 1:43899611-43899633 GGCCGCTGCATGGCGCCCTCGGG - Exonic
906486663 1:46240490-46240512 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
907453909 1:54563053-54563075 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
911449569 1:98046056-98046078 GGCCGCTGCCCCCCTGCCGCTGG + Intergenic
912825471 1:112899303-112899325 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
912844673 1:113068802-113068824 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
913680939 1:121186589-121186611 GGCCGCTGCCCAGCGCTGGCGGG + Intronic
914032770 1:143974228-143974250 GGCCGCTGCCCAGCGCTGGCGGG + Intergenic
914156675 1:145093737-145093759 GGCCGCTGCCCAGCGCTGGCGGG - Intronic
914242275 1:145859796-145859818 GGCCGCGGCTCCGCCCGGGCCGG + Intronic
915278909 1:154808977-154808999 GGTGGCTGCTCTGCGCCCACTGG + Intronic
920468252 1:206205113-206205135 GGCCGCTGCCCAGCGCTGGCGGG + Intronic
922250505 1:223845576-223845598 GGGGGCTGGTCCGCGCCCTCGGG - Intronic
1065025119 10:21534162-21534184 GGCCGCGGCAGCGCGCACGCAGG + Intronic
1065188613 10:23191984-23192006 CGGCGCTGCTCAGCGCGCGCGGG + Intergenic
1065189879 10:23199185-23199207 GCCCGCTGCTCCGCGTTCCCAGG + Intergenic
1065335705 10:24655563-24655585 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
1065367875 10:24952717-24952739 GGCCGCTGCTTCCCGCCGGCGGG - Intergenic
1068545019 10:58335244-58335266 GGCCGCTGCCCCGCAGCCCCAGG - Intronic
1068548916 10:58385032-58385054 GGCGGCTGCTGCGCGCCCAGCGG - Exonic
1069019155 10:63466028-63466050 GGCTGCTGCCCCGCCCGCGCCGG - Intergenic
1070318242 10:75334184-75334206 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1070768378 10:79069135-79069157 GGCTCCTGCTCCGCGCCGGCTGG - Exonic
1071086674 10:81874756-81874778 GGCGGCTGCTCCGCGAGCCCGGG - Intergenic
1072150160 10:92675972-92675994 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1072656663 10:97334626-97334648 GCCCGCAGCTCCGCGCCCGCGGG - Exonic
1072903579 10:99430663-99430685 GGCCGCGGGCCCGCCCCCGCCGG - Intergenic
1072950113 10:99840112-99840134 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1073061726 10:100737419-100737441 GGCCGCTGTGCCACGCGCGCCGG - Intronic
1073240744 10:102056154-102056176 TGCCGCTGCTCCGGGCTCACGGG + Exonic
1076150905 10:128161322-128161344 TGCCGCTGCTCAGAGCCAGCAGG - Intergenic
1076283738 10:129273968-129273990 GGCTGCTGCTCTGTGCCAGCAGG + Intergenic
1076558030 10:131342686-131342708 TGCCCCTGCTCAGCGCCCACAGG + Intergenic
1076724134 10:132405467-132405489 GGCGGCAGGTCCGCGCCGGCCGG - Exonic
1076878809 10:133230287-133230309 GGATGCTGCTCCGGCCCCGCAGG + Exonic
1077090853 11:777607-777629 GCCCGCCGCTCCGCGCGCCCGGG + Exonic
1077177644 11:1197914-1197936 AGCCGCTGCCCCGCGCCCGTGGG + Intronic
1080540107 11:33257342-33257364 GGCCCCTCCTCCGCGCTCGTCGG - Intronic
1081784942 11:45739161-45739183 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1081981423 11:47269588-47269610 GGCCGCGCCGCGGCGCCCGCTGG - Intronic
1082076585 11:47980386-47980408 GGCCGCGGATCCCCTCCCGCGGG - Intergenic
1083541611 11:63515492-63515514 GGCCGCTGCTCAGCCCCCAGGGG - Intronic
1083593691 11:63909289-63909311 GGCCGCTGCGCCGCCCCACCTGG + Exonic
1083655249 11:64226290-64226312 GGCGGCTGGTGAGCGCCCGCTGG + Exonic
1084650281 11:70485534-70485556 GCCCGCTCCCCCGCCCCCGCCGG - Intronic
1091762432 12:3095982-3096004 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1092263048 12:6962683-6962705 GGCTGATGCTCCGGGCCAGCTGG + Intergenic
1093958856 12:25251120-25251142 GGCCCCCGCTCCTCCCCCGCCGG - Intergenic
1095439356 12:42227188-42227210 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
1096022473 12:48333750-48333772 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1099989492 12:89708325-89708347 AGTCGCTGCTCCGGGCCCGAGGG - Intronic
1102578402 12:113871874-113871896 GGCGGCTGCTCCTTGCCCTCCGG - Intronic
1102854152 12:116278094-116278116 GGCCGCCGCGCCACGCCAGCCGG - Intergenic
1103853715 12:123950118-123950140 TGCCGCTTCTCCTAGCCCGCAGG + Intronic
1103954242 12:124567571-124567593 GCCCGCGGCTCCGCGCTCCCCGG + Intronic
1104150284 12:126075538-126075560 GGCAGGTGCTCTGGGCCCGCAGG - Intergenic
1104624318 12:130339090-130339112 CGCCGCTGCGCTGCGCCCCCGGG + Intronic
1104937694 12:132375312-132375334 GGCCGCGGCTCGGCCCCCTCAGG - Intergenic
1105018667 12:132802020-132802042 GTCCGCAGCTCCGCGCGTGCGGG + Intronic
1108403971 13:50081558-50081580 GGCGGCTGCTCCGCCGCAGCCGG + Intergenic
1110269189 13:73574293-73574315 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1112339709 13:98543082-98543104 GGCCGCAGCTCCGCTCCGGCTGG + Intronic
1112494781 13:99896082-99896104 GGCCCCGGCTCCGCGCGCACCGG - Exonic
1113841290 13:113363172-113363194 TGCCGCTCCTCCGCGACCCCAGG - Intronic
1114617706 14:24076982-24077004 GGCCGGTGCTCTGCTCCCGCTGG - Exonic
1114957819 14:27845703-27845725 GCCCTCTGCTCCGCGGCGGCTGG + Intergenic
1115609560 14:35038559-35038581 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1116871651 14:50073974-50073996 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121595093 14:95156773-95156795 GGCCGCTGTGCCGCGCCCGGAGG - Intronic
1122831138 14:104396529-104396551 GGCTGCTGCTCCGTGCTCACTGG - Intergenic
1122964011 14:105112682-105112704 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1124254664 15:28130977-28130999 GCCTGCTGCTCCTCCCCCGCGGG - Intronic
1125079050 15:35655578-35655600 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1125659016 15:41381947-41381969 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1128269138 15:66293561-66293583 GCCCGCCACTCCGCGGCCGCCGG + Exonic
1128992510 15:72272557-72272579 GCCTGCCGCTCCGCCCCCGCGGG - Exonic
1129428284 15:75480820-75480842 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
1130040934 15:80404630-80404652 AGCTGCGGCTCCGCGCCCCCGGG - Intronic
1130305780 15:82711333-82711355 GCCCGCTGCTGCGCTCCTGCTGG - Intergenic
1130908471 15:88255785-88255807 CGCCGCTGCCCGCCGCCCGCTGG - Intronic
1131263576 15:90902812-90902834 CGCCGCTGCCGCGCTCCCGCTGG - Intronic
1132365279 15:101252154-101252176 GGCCCCCGCCCGGCGCCCGCGGG + Intergenic
1132406408 15:101544037-101544059 GCCCCCTGCCCCGCGCGCGCAGG + Intergenic
1132559862 16:588708-588730 GGGCTCTGCTCCTCGCCGGCGGG + Intergenic
1132613418 16:828832-828854 GCCTGCTGCTCCGGGGCCGCTGG + Intergenic
1132934580 16:2474214-2474236 GGCCGCCGCCCCGTCCCCGCCGG + Intergenic
1133021862 16:2970304-2970326 GGCCCCTCCTCCGCGCCCCGCGG + Intronic
1133784499 16:8963750-8963772 GCCCGCTCCGCCGCTCCCGCCGG - Intronic
1136454024 16:30370285-30370307 GGGCGCGGCTCGGCGCGCGCCGG + Intergenic
1138456235 16:57122341-57122363 GGCCGCTGCTCTCCACCAGCAGG + Intronic
1139908326 16:70381409-70381431 GGCCGCTGGCCCGCCCCCGAAGG + Exonic
1141079232 16:81036021-81036043 GGCTGCTGCGTCGCCCCCGCGGG - Exonic
1141748947 16:85945568-85945590 TGCTGCTGCTCCTCTCCCGCGGG + Intergenic
1142638197 17:1270636-1270658 GGCCCCTGCCCCGAGCCCGGGGG + Exonic
1144641931 17:16942291-16942313 GGCCGGTGCTCCAAGCCCGCGGG + Intronic
1145205678 17:20984029-20984051 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1146271438 17:31488188-31488210 CGCCGCCGACCCGCGCCCGCTGG + Intronic
1147006397 17:37407107-37407129 GCCCGCCGCTGCCCGCCCGCCGG - Intronic
1147150270 17:38510190-38510212 GGCCGCTCCTCCGGCGCCGCCGG - Exonic
1147179128 17:38673912-38673934 GGCCTCTCCACCGAGCCCGCGGG - Exonic
1147963195 17:44180031-44180053 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1148225438 17:45895508-45895530 GGCCGCTGGTCCCCGTTCGCGGG + Intronic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1149908738 17:60550863-60550885 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1149997562 17:61412833-61412855 GTCCTCTTCTGCGCGCCCGCGGG + Exonic
1150266432 17:63835057-63835079 GGGCGCTGCTCCAAGCCCGTTGG - Intronic
1151212773 17:72557151-72557173 GGCAGCTCCTCTGGGCCCGCGGG - Intergenic
1151657434 17:75502472-75502494 GGCCTTTGCGCCGGGCCCGCAGG + Exonic
1151724974 17:75878393-75878415 GGCCGCGCCTCCGGGTCCGCCGG + Exonic
1152801083 17:82330959-82330981 GGCCGCTGCTTCTCACACGCGGG + Intronic
1153688496 18:7568297-7568319 GGCCGCTGCTCGGGGTCGGCGGG - Intronic
1157614005 18:48976171-48976193 CGCCGCCGCCCCGCTCCCGCGGG - Intergenic
1159040682 18:63320400-63320422 GCCCGCTCCGCTGCGCCCGCGGG + Intergenic
1160703731 19:519592-519614 GGCCGCCCCTCCACCCCCGCGGG + Exonic
1160824103 19:1071429-1071451 AGCCGCTGCTCCCCCACCGCGGG - Intronic
1161589553 19:5123152-5123174 GGCCACTGCTCCACGCCCTGTGG + Intronic
1162128447 19:8511650-8511672 GGCCGCTGCACCCGGGCCGCCGG - Exonic
1162775300 19:12975455-12975477 GGCCCCTGCCCCGCCCCCCCAGG + Intergenic
1162886702 19:13702789-13702811 GGCGGCTGCTCCTTGCCCTCAGG - Intergenic
1163019201 19:14473619-14473641 TGGCCCTGCTACGCGCCCGCTGG - Exonic
1163019259 19:14473877-14473899 GGCCGCTGCTCCACGCCGCGCGG - Exonic
1163159726 19:15457473-15457495 GCCCGCAGCGCTGCGCCCGCCGG + Exonic
1163427100 19:17245754-17245776 GGCTGCCGCTCCGGGCCTGCAGG + Exonic
1163817371 19:19475146-19475168 CGCAGCTGCTCCCGGCCCGCCGG + Intronic
1163906077 19:20150695-20150717 GGCAGCTGCTCCTTGCCCTCGGG + Intergenic
1164191917 19:22925535-22925557 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1164647759 19:29872316-29872338 AGCCCCTGCTCCCCGCCCGCGGG + Intergenic
1164653330 19:29901688-29901710 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1165058663 19:33194524-33194546 GGCCGCCGCTGAGCCCCCGCAGG + Intronic
1166261448 19:41644259-41644281 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
1168718974 19:58544598-58544620 GGCCGCTGCCCGCCGCGCGCGGG - Exonic
1202712323 1_KI270714v1_random:25256-25278 CGCCGCTCCTCCTCGCCCACCGG - Intergenic
926147306 2:10404604-10404626 GGGGGCTGCTCAGCGCCTGCAGG - Intronic
926206068 2:10835163-10835185 GGCCGCTGCTCGGCCCCGGGCGG + Intronic
929539841 2:42811044-42811066 GGCCGCTGCCCCTCGCCCCCGGG + Intergenic
929614382 2:43296888-43296910 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
930011457 2:46941155-46941177 GGCCGCGGCTCCACCCCCGCGGG - Exonic
931602550 2:64019072-64019094 CGCCCCCGCCCCGCGCCCGCTGG + Exonic
936545995 2:113393830-113393852 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
937904514 2:127046349-127046371 GGCCGCTGCCCCTCCCCAGCAGG + Intergenic
937917651 2:127106803-127106825 GGCCGGGGCTCCGCGGCGGCTGG + Intronic
937919682 2:127120485-127120507 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
937996970 2:127701586-127701608 AGCAGCGGCTCCGCGGCCGCCGG - Exonic
938133650 2:128736891-128736913 GGCCGCGGCTCCACCCCCTCTGG + Intergenic
940220258 2:151344024-151344046 AGCCGCTGCTCCCGGCCTGCTGG - Intergenic
941384939 2:164841385-164841407 GGCCCCGGCTCCCAGCCCGCGGG + Exonic
941978909 2:171434052-171434074 GGCGGCAGCACCGCGCCCCCAGG + Intronic
942459115 2:176157426-176157448 GGCCGCGCTCCCGCGCCCGCCGG - Intronic
942460564 2:176165421-176165443 GCCCGCTTCCCCGGGCCCGCCGG - Intronic
943725245 2:191245739-191245761 GCCCGCTGACCCCCGCCCGCAGG - Intronic
945319567 2:208406492-208406514 GGCCGATGGTCAGCGCACGCAGG + Intronic
948479264 2:238239991-238240013 GGCTGCTGCTGGGCGGCCGCGGG - Exonic
1168913302 20:1466998-1467020 CCCCGCCGCTCCGCGCCCTCTGG + Intronic
1169211575 20:3768582-3768604 TGCCGGTGCTCTCCGCCCGCCGG + Intergenic
1170425161 20:16228395-16228417 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1171131074 20:22653236-22653258 GGCCCCTGCTCCACCCCTGCAGG - Intergenic
1172028950 20:31968255-31968277 CGCCGCCTCCCCGCGCCCGCCGG - Exonic
1172061494 20:32190087-32190109 GGCCGCTTCCCCGCGCCCAGGGG + Intergenic
1172350052 20:34231322-34231344 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1174358721 20:50015096-50015118 GGCCGCTGGAGCCCGCCCGCAGG - Intergenic
1174494573 20:50930791-50930813 GGCCGCGGGTCCGCGCGCGGCGG + Intronic
1176047853 20:63101973-63101995 GGCTGCTGCTCCGCGGGCTCTGG + Intergenic
1177178629 21:17721099-17721121 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1178334505 21:31731707-31731729 GGCGGCTGCTCCGGGCCCGCCGG + Exonic
1178555774 21:33588744-33588766 GGCCCCGCCTCCGCCCCCGCCGG + Intronic
1178992134 21:37365987-37366009 GGACGCTGCGCCGGGCCCGGCGG - Intronic
1179522096 21:41952468-41952490 GGCCGCTGCTCCGCCCTTCCAGG - Intronic
1181934556 22:26429416-26429438 GTCCGCGGGTCCGCGCCCTCGGG + Exonic
1183702321 22:39457495-39457517 GGCGGCGGCTCCGCGGCCCCCGG - Exonic
1183841628 22:40502699-40502721 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1183845115 22:40536453-40536475 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
950253860 3:11488292-11488314 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
950264686 3:11564964-11564986 GGCTGCGGCTCCGCTCCCGGGGG + Exonic
950683915 3:14603024-14603046 GGCCCCGGCCCCGCCCCCGCCGG + Intergenic
952896676 3:38082442-38082464 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
953020536 3:39110280-39110302 GGCTGCTGCTCCTCTCCCCCTGG + Intronic
954080530 3:48210877-48210899 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
954610377 3:51941873-51941895 GGCCGCTGCTACACGCCTGGTGG - Exonic
955297230 3:57746971-57746993 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
956270219 3:67443400-67443422 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
958034041 3:88149618-88149640 GGCGGCTCCTCCCCGCCCGCTGG - Intronic
959042505 3:101438882-101438904 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
959419583 3:106112620-106112642 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
960747694 3:120908246-120908268 GGCCGCTTCTCTGGGCCCTCTGG - Exonic
965757412 3:172040307-172040329 GGCCGCCTCTCCGCGCCGGCGGG + Intronic
966359459 3:179119506-179119528 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
968636629 4:1684332-1684354 GGCCGCCGCCCCGCCCCCTCCGG + Intergenic
968756255 4:2417907-2417929 GGGGTCTGCTCCGGGCCCGCGGG + Intronic
968934159 4:3601259-3601281 GGCCCCTGCTCCCTGACCGCTGG - Intergenic
969214593 4:5711614-5711636 AGCCGGGGCTCCGGGCCCGCAGG - Intronic
969288413 4:6222467-6222489 GGCCGCTGCTCCGGGCGGACGGG + Intergenic
969671524 4:8592754-8592776 GGCCGGGGCTCTGCGCTCGCTGG - Exonic
969690270 4:8700373-8700395 GGCCGCTTCTCCTCCCCGGCTGG - Intergenic
970824079 4:20252590-20252612 GGCCGTGGCTCTGCGCCCTCCGG + Intergenic
972321597 4:37977468-37977490 GGCGGCGGCTCTTCGCCCGCCGG - Intronic
978617472 4:110611558-110611580 CGCCGCTGCTCCGGGCCTGGCGG - Intergenic
978617484 4:110611612-110611634 GGCCCCTGCTTCGCCCCAGCTGG + Intergenic
981061269 4:140427623-140427645 AGTCGCTGCTGCGCGGCCGCCGG - Exonic
982616096 4:157637741-157637763 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
985580486 5:693233-693255 GCCCCCCGCGCCGCGCCCGCGGG + Intronic
985595144 5:784623-784645 GCCCCCCGCGCCGCGCCCGCAGG + Intergenic
992373724 5:76171089-76171111 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
998307915 5:141096963-141096985 GGTCGCTGCTCGGTGCCCGAGGG + Exonic
998308551 5:141102816-141102838 GGTCGCTGCTCGGTGCCCGAGGG + Exonic
998310458 5:141124162-141124184 GGTCGCTGCTCGGTGCCCGAGGG + Exonic
998311615 5:141137598-141137620 GGTCGCTGCTCGGTGCCCGAGGG + Exonic
998316763 5:141189485-141189507 GGTCGCTGCTCGGTGCCCGAGGG + Exonic
998317397 5:141194725-141194747 GGTCGCTGCTCGGTGCCCGAGGG + Exonic
998320569 5:141225672-141225694 GGTCGCTGCTCGGTGCCCGAGGG + Exonic
998322801 5:141247745-141247767 GGTCGCTGCTCGGTGCCCGAGGG + Exonic
998406270 5:141876367-141876389 GCCCGCTGCGCCGCTCGCGCCGG - Intronic
1000985251 5:167858859-167858881 GGCAGCTGCTCCTTGCCCTCGGG - Intronic
1001309643 5:170601828-170601850 GGCCCCTGCTCGACGTCCGCAGG - Intronic
1001984211 5:176060563-176060585 AGCCGCAGCTCCGCGCCTGCGGG - Intronic
1002233264 5:177783502-177783524 AGCCGCAGCTCCGCGCCTGCGGG + Intronic
1002262714 5:178006279-178006301 AGCCGCAGCTCCGCGCCTGCGGG - Intergenic
1002296126 5:178232341-178232363 GGCCGCTGCCCCGGCCCCGCTGG - Intronic
1002341408 5:178518789-178518811 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1002700686 5:181122434-181122456 GGCCGCTTCTTCTCCCCCGCCGG + Intergenic
1002922917 6:1585822-1585844 GGCTACTGCTCAGCGCCCACAGG + Intergenic
1004387952 6:15188476-15188498 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1006180388 6:32150520-32150542 TGCCGCCGCCCCGCCCCCGCCGG - Exonic
1006396249 6:33789175-33789197 GCCCGCTCCGCCGCGCCTGCGGG - Intergenic
1006492134 6:34397009-34397031 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
1006642648 6:35496929-35496951 GGCCGCTCCGCCGGGCCCGAGGG + Exonic
1006694587 6:35920685-35920707 GGGCGCTGCTCTGCGCCCCGTGG - Intronic
1007674425 6:43581540-43581562 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1007902039 6:45422010-45422032 GGCCGCCGCTCCCCCCGCGCGGG - Intronic
1011405419 6:87010794-87010816 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1012912897 6:105137229-105137251 GCCCGCCGCCCCGCGCCCCCCGG + Intergenic
1013793607 6:113860167-113860189 GGCCGCAGCTGCGCCCCCGGCGG - Exonic
1015476543 6:133664319-133664341 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1015626336 6:135183088-135183110 GGCAGCGGCTCCGCGCCCCGAGG + Intronic
1015773530 6:136792226-136792248 CGGGGCTGCTCCGCGCCCGCCGG + Exonic
1019180909 6:170186904-170186926 GGATGCTGCTCAGCCCCCGCAGG - Intergenic
1019475033 7:1240371-1240393 GGCCCCTGCTCCCCGCCCAGAGG - Intergenic
1019562742 7:1666379-1666401 GGCCGAGTCTCCCCGCCCGCGGG + Intergenic
1019828228 7:3301290-3301312 GGCGGCTCCTCCGCGCCCGGCGG + Intergenic
1019929095 7:4211551-4211573 GGCTGCTGCTCTGCACCTGCTGG + Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1020616624 7:10466414-10466436 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1021872152 7:25017984-25018006 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1022697933 7:32728421-32728443 GGCCGCCGCTCGGCGCCCCGAGG - Intergenic
1029708404 7:102287073-102287095 GGCCGCAGCTGCGCGCCTGTAGG + Intronic
1032125142 7:129188444-129188466 TGCCGCCGCCCCGCGCCCGGGGG - Intergenic
1034188371 7:149195967-149195989 GACCGCTGCTCCGCGCCGCGCGG - Intronic
1034421565 7:150993607-150993629 AGCCTCAGCTCCACGCCCGCTGG - Intronic
1034436030 7:151063158-151063180 GGCCGCTGCTCCGCGCCCGCAGG + Intronic
1035022686 7:155808623-155808645 GGCCTCTCCTCCGCCCGCGCTGG + Intronic
1035094817 7:156345665-156345687 GGCCGCTGTTCCCCGCTCGCTGG - Intergenic
1035463631 7:159061919-159061941 GGCCGCCGCTCCCCTCCCACCGG - Intronic
1035508101 8:150576-150598 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1036466565 8:9003133-9003155 GGCGGCTCCTCCCCGCCCTCCGG - Exonic
1036536866 8:9658287-9658309 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1036755078 8:11466427-11466449 GGCCGCTCATGCGCTCCCGCGGG - Intronic
1037529212 8:19757314-19757336 CGCCGCTGCTCCCCGCCCCCGGG - Intronic
1042048823 8:64685214-64685236 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
1043844960 8:85152947-85152969 AGCCCCTGCTCCGCGGCCCCTGG + Intergenic
1044660474 8:94590244-94590266 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1047687129 8:127315910-127315932 GGCGGCTGCTCCCTGCCCTCGGG - Intergenic
1047848263 8:128827113-128827135 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1048072985 8:131040791-131040813 GCCCACTGCTCCGCGGCTGCAGG + Exonic
1049064145 8:140299548-140299570 GGCCGCTGCTTGGCGACTGCCGG - Intronic
1049608600 8:143541481-143541503 GCCCGCTCCGCCCCGCCCGCGGG - Intergenic
1053256029 9:36616001-36616023 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1053457077 9:38241580-38241602 GGCGGCTGCTCCTTGCCCTCGGG - Intergenic
1057259746 9:93576939-93576961 GCCCCCGGCTGCGCGCCCGCAGG + Intronic
1057266168 9:93619539-93619561 GGCCTGTGCTCCACGCCTGCTGG + Intronic
1057266177 9:93619573-93619595 GGCCTGTGCTCCACGCCTGCTGG + Intronic
1059210869 9:112513740-112513762 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
1060064788 9:120495093-120495115 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
1060951782 9:127608591-127608613 GGACGCACCTGCGCGCCCGCTGG + Intergenic
1061208454 9:129177415-129177437 GCCGCCTGCTCCGCGCCCCCAGG - Exonic
1061534347 9:131238497-131238519 GGCCTCTGCCCAGCCCCCGCCGG - Intergenic
1061680920 9:132242103-132242125 GGCCGCTGAGCCCCGCCCGGAGG + Exonic
1061873902 9:133534610-133534632 GGCCGCTCCCCCGCCCGCGCCGG - Intronic
1061984082 9:134119029-134119051 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1062403608 9:136383193-136383215 GCCTGCTTCTCTGCGCCCGCCGG + Exonic
1062653531 9:137590429-137590451 CGCCGCCGCCTCGCGCCCGCCGG + Exonic
1203768401 EBV:38362-38384 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768451 EBV:38487-38509 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768501 EBV:38612-38634 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768551 EBV:38737-38759 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768601 EBV:38862-38884 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768651 EBV:38987-39009 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768701 EBV:39112-39134 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768751 EBV:39237-39259 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768801 EBV:39362-39384 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768851 EBV:39487-39509 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768901 EBV:39612-39634 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203768951 EBV:39737-39759 GGCCGCTGCCCCGCTCCGGGTGG + Intergenic
1203779274 EBV:91830-91852 GGCCGAGGCCCCGCGCCTGCGGG - Intergenic
1203788393 EBV:140810-140832 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788437 EBV:140912-140934 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788481 EBV:141014-141036 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788525 EBV:141116-141138 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788569 EBV:141218-141240 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788613 EBV:141320-141342 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788657 EBV:141422-141444 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788701 EBV:141524-141546 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788745 EBV:141626-141648 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788789 EBV:141728-141750 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788833 EBV:141830-141852 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788877 EBV:141932-141954 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788921 EBV:142034-142056 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203788965 EBV:142136-142158 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789009 EBV:142238-142260 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789053 EBV:142340-142362 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789097 EBV:142442-142464 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789141 EBV:142544-142566 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789185 EBV:142646-142668 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789229 EBV:142748-142770 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789273 EBV:142850-142872 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789317 EBV:142952-142974 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789361 EBV:143054-143076 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789405 EBV:143156-143178 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1203789449 EBV:143258-143280 GTCCGCTGCCCCGCTCCGGCGGG + Intergenic
1187341671 X:18426090-18426112 GGCCCCTCCTCGGCGCCGGCGGG - Intronic
1187698160 X:21941093-21941115 GGCCGCAGCTCGGGGCCTGCAGG + Intronic
1187976687 X:24710036-24710058 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1191251975 X:58264121-58264143 AGCCCCTGCGCCGGGCCCGCGGG + Intergenic
1191618303 X:63190302-63190324 GGCGGCTGCTCCTTGCCCTCGGG + Intergenic
1191830125 X:65407263-65407285 GGCCGCTGCTCCTCGAGCTCGGG - Intronic
1192621089 X:72680874-72680896 GGCGGCTGCTCCTTGCCCTCGGG - Intronic
1195036312 X:100973360-100973382 GGCGGCTGCTCCTTGCCCTCGGG + Intronic
1199724656 X:150568595-150568617 GGGCCCTGCTCCGCCCCCTCTGG - Intergenic