ID: 1034439661

View in Genome Browser
Species Human (GRCh38)
Location 7:151080333-151080355
Sequence CTGTGGGAGAGGGAGGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6381
Summary {0: 1, 1: 0, 2: 8, 3: 327, 4: 6045}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034439661_1034439675 2 Left 1034439661 7:151080333-151080355 CCGACCACCTCCCTCTCCCACAG 0: 1
1: 0
2: 8
3: 327
4: 6045
Right 1034439675 7:151080358-151080380 GGCGGCGGCGGCACAGAGGGTGG 0: 1
1: 0
2: 6
3: 100
4: 807
1034439661_1034439680 26 Left 1034439661 7:151080333-151080355 CCGACCACCTCCCTCTCCCACAG 0: 1
1: 0
2: 8
3: 327
4: 6045
Right 1034439680 7:151080382-151080404 ACGCGGGCTCCGCGGCTGGACGG 0: 1
1: 0
2: 0
3: 9
4: 64
1034439661_1034439676 9 Left 1034439661 7:151080333-151080355 CCGACCACCTCCCTCTCCCACAG 0: 1
1: 0
2: 8
3: 327
4: 6045
Right 1034439676 7:151080365-151080387 GCGGCACAGAGGGTGGAACGCGG 0: 1
1: 0
2: 0
3: 5
4: 141
1034439661_1034439677 10 Left 1034439661 7:151080333-151080355 CCGACCACCTCCCTCTCCCACAG 0: 1
1: 0
2: 8
3: 327
4: 6045
Right 1034439677 7:151080366-151080388 CGGCACAGAGGGTGGAACGCGGG 0: 1
1: 0
2: 0
3: 7
4: 128
1034439661_1034439673 -2 Left 1034439661 7:151080333-151080355 CCGACCACCTCCCTCTCCCACAG 0: 1
1: 0
2: 8
3: 327
4: 6045
Right 1034439673 7:151080354-151080376 AGGAGGCGGCGGCGGCACAGAGG 0: 1
1: 1
2: 9
3: 85
4: 600
1034439661_1034439670 -10 Left 1034439661 7:151080333-151080355 CCGACCACCTCCCTCTCCCACAG 0: 1
1: 0
2: 8
3: 327
4: 6045
Right 1034439670 7:151080346-151080368 TCTCCCACAGGAGGCGGCGGCGG 0: 1
1: 0
2: 1
3: 25
4: 185
1034439661_1034439678 18 Left 1034439661 7:151080333-151080355 CCGACCACCTCCCTCTCCCACAG 0: 1
1: 0
2: 8
3: 327
4: 6045
Right 1034439678 7:151080374-151080396 AGGGTGGAACGCGGGCTCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 85
1034439661_1034439674 -1 Left 1034439661 7:151080333-151080355 CCGACCACCTCCCTCTCCCACAG 0: 1
1: 0
2: 8
3: 327
4: 6045
Right 1034439674 7:151080355-151080377 GGAGGCGGCGGCGGCACAGAGGG 0: 1
1: 0
2: 12
3: 105
4: 844
1034439661_1034439679 22 Left 1034439661 7:151080333-151080355 CCGACCACCTCCCTCTCCCACAG 0: 1
1: 0
2: 8
3: 327
4: 6045
Right 1034439679 7:151080378-151080400 TGGAACGCGGGCTCCGCGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034439661 Original CRISPR CTGTGGGAGAGGGAGGTGGT CGG (reversed) Intronic
Too many off-targets to display for this crispr