ID: 1034441026

View in Genome Browser
Species Human (GRCh38)
Location 7:151086265-151086287
Sequence GCGCTCCAGCCCTGGCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 360}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034441026_1034441033 -8 Left 1034441026 7:151086265-151086287 CCGGGGCGCCAGGGCTGGAGCGC 0: 1
1: 0
2: 1
3: 27
4: 360
Right 1034441033 7:151086280-151086302 TGGAGCGCGCGGCTCGGGGGTGG No data
1034441026_1034441042 28 Left 1034441026 7:151086265-151086287 CCGGGGCGCCAGGGCTGGAGCGC 0: 1
1: 0
2: 1
3: 27
4: 360
Right 1034441042 7:151086316-151086338 AGCGAGCGAGCGAGGGGCGGGGG No data
1034441026_1034441038 25 Left 1034441026 7:151086265-151086287 CCGGGGCGCCAGGGCTGGAGCGC 0: 1
1: 0
2: 1
3: 27
4: 360
Right 1034441038 7:151086313-151086335 GCCAGCGAGCGAGCGAGGGGCGG 0: 1
1: 0
2: 4
3: 32
4: 271
1034441026_1034441034 -5 Left 1034441026 7:151086265-151086287 CCGGGGCGCCAGGGCTGGAGCGC 0: 1
1: 0
2: 1
3: 27
4: 360
Right 1034441034 7:151086283-151086305 AGCGCGCGGCTCGGGGGTGGAGG 0: 1
1: 0
2: 2
3: 41
4: 292
1034441026_1034441041 27 Left 1034441026 7:151086265-151086287 CCGGGGCGCCAGGGCTGGAGCGC 0: 1
1: 0
2: 1
3: 27
4: 360
Right 1034441041 7:151086315-151086337 CAGCGAGCGAGCGAGGGGCGGGG No data
1034441026_1034441037 22 Left 1034441026 7:151086265-151086287 CCGGGGCGCCAGGGCTGGAGCGC 0: 1
1: 0
2: 1
3: 27
4: 360
Right 1034441037 7:151086310-151086332 AGAGCCAGCGAGCGAGCGAGGGG No data
1034441026_1034441040 26 Left 1034441026 7:151086265-151086287 CCGGGGCGCCAGGGCTGGAGCGC 0: 1
1: 0
2: 1
3: 27
4: 360
Right 1034441040 7:151086314-151086336 CCAGCGAGCGAGCGAGGGGCGGG 0: 1
1: 0
2: 1
3: 32
4: 234
1034441026_1034441036 21 Left 1034441026 7:151086265-151086287 CCGGGGCGCCAGGGCTGGAGCGC 0: 1
1: 0
2: 1
3: 27
4: 360
Right 1034441036 7:151086309-151086331 CAGAGCCAGCGAGCGAGCGAGGG No data
1034441026_1034441035 20 Left 1034441026 7:151086265-151086287 CCGGGGCGCCAGGGCTGGAGCGC 0: 1
1: 0
2: 1
3: 27
4: 360
Right 1034441035 7:151086308-151086330 GCAGAGCCAGCGAGCGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034441026 Original CRISPR GCGCTCCAGCCCTGGCGCCC CGG (reversed) Intronic
900309772 1:2028089-2028111 GCGCTCCTGCCAGGGCTCCCGGG + Intronic
901003908 1:6162510-6162532 GCGGCCCAGCCCTGGAGACCTGG - Intronic
901103642 1:6738337-6738359 GGGCTCCAGCTCTGTTGCCCTGG + Intergenic
901152285 1:7111848-7111870 GCACTCCAGCCTGGGCGACCGGG + Intronic
901851830 1:12020716-12020738 GCGCTCCAGCCTGGGCGACAGGG - Intronic
901855757 1:12043270-12043292 GCGCCTCTGCCCTGCCGCCCCGG + Intergenic
902072243 1:13749695-13749717 GCCCTCCCGCCCTGCCGACCCGG + Intronic
903010997 1:20330417-20330439 GCGCCCCAGCCCCGGCAGCCTGG - Intronic
903249590 1:22043148-22043170 GGGCTCCGGCCATGCCGCCCTGG - Intergenic
903542117 1:24102306-24102328 GCTCTCCAGGCCTGGGGGCCAGG + Intronic
903666723 1:25012451-25012473 GAGCGCCAGCCCTGGAGCCCAGG - Intergenic
903950600 1:26993991-26994013 GAGCTGCAGCGCTGGCGCCAGGG + Exonic
903986915 1:27235042-27235064 CGGCTCCAGCCCTGCCGGCCTGG + Intronic
904199876 1:28812627-28812649 GGGCTCCAGCCCTGCGGCGCCGG - Intronic
905308607 1:37034820-37034842 GCGCTCCACGCCTGGCTCCCGGG - Intergenic
905869351 1:41394359-41394381 GGGCTCCTGCCCTGTCACCCTGG - Intergenic
906775185 1:48522889-48522911 GCGCTCCAGCCTGGGCGACAGGG + Intergenic
907196582 1:52692144-52692166 TGTCTCCAGCCCTGGCTCCCTGG + Intronic
908558505 1:65281959-65281981 GCACTCCAGCCCTGGTGACTGGG - Intronic
909392970 1:75136634-75136656 GGACTACAGCCCTGGCGGCCGGG + Exonic
910879085 1:91906282-91906304 GCACTCCAGCCCGGGCGACAGGG + Intronic
912602337 1:110949452-110949474 GCACTCCAGCCCAGGCGACAGGG - Intronic
913536664 1:119779536-119779558 GTACTCCAGCCCTGACCCCCAGG + Intergenic
913564736 1:120061880-120061902 TCGCTCCAGCCATGGTACCCCGG - Intronic
913633395 1:120731683-120731705 TCGCTCCAGCCATGGTACCCCGG + Intergenic
914285323 1:146221230-146221252 TCGCTCCAGCCATGGTACCCCGG - Intronic
914546354 1:148671985-148672007 TCGCTCCAGCCATGGTACCCCGG - Intronic
914620211 1:149398685-149398707 TCGCTCCAGCCATGGTACCCCGG + Intergenic
914702949 1:150150388-150150410 GCGCCCCCGCCCCGGCGGCCCGG + Intronic
914845912 1:151283291-151283313 GCGCTGCAGGCCTTGGGCCCGGG + Intronic
915302996 1:154962056-154962078 GCGCCCCAGCACCGGCCCCCGGG - Intronic
915368985 1:155331988-155332010 GCACTCCAGCCCGGGCGACAGGG + Intergenic
915475285 1:156149628-156149650 GCGGTCCAGCTGTGTCGCCCCGG + Intronic
916084633 1:161259405-161259427 GAACTCCATCCCTGGCCCCCGGG + Intronic
916133548 1:161631969-161631991 GCCCTGGAGCCCTGGAGCCCTGG - Intronic
919841000 1:201609398-201609420 GCCCTCCAGCCCAGAGGCCCAGG - Intergenic
920385950 1:205570017-205570039 ACTCTCCAGCCCTGGTGCCAAGG + Intronic
922952225 1:229568758-229568780 GCACTCCAGCCCTCCAGCCCGGG - Intergenic
923644135 1:235798541-235798563 GCACTCCAGCCTTGGCGACAAGG + Intronic
924418761 1:243887489-243887511 GCGCTCCAGCCTGGGCGACAGGG - Intergenic
924670204 1:246116103-246116125 GCGCTCCAGCCTGGGCGACAAGG + Intronic
1063593346 10:7411887-7411909 GCGTTCCTCCCCAGGCGCCCGGG - Intergenic
1064059979 10:12129490-12129512 GCGCGCCAGCCCCGCCTCCCGGG + Intergenic
1065122271 10:22541850-22541872 GCTCACCACCCCTGGCTCCCGGG - Exonic
1067061550 10:43080509-43080531 GCTCCCCAGCCCTGGCCCTCTGG + Intronic
1068750183 10:60583612-60583634 GCGCTCCAGTTCTGTCACCCAGG + Intronic
1069621620 10:69840900-69840922 CCCTTCCAGCTCTGGCGCCCGGG - Intronic
1069651305 10:70051997-70052019 CCCCTCCAGCCATGGAGCCCTGG + Intergenic
1069876989 10:71569046-71569068 CCGCTCCAGCCCTGGGTGCCTGG + Intronic
1069992955 10:72326051-72326073 GCCCGCCGGCCCTGCCGCCCCGG + Intergenic
1070046868 10:72847004-72847026 GCACTCCAGCCCGGGCGACAGGG - Intronic
1070280374 10:75043999-75044021 GCGGTCCAGCGCCGTCGCCCTGG + Exonic
1071483080 10:86079427-86079449 GCCCTGGAGCCCTGGAGCCCTGG - Intronic
1071563336 10:86659275-86659297 GAGCACCTGCCCTGGCTCCCAGG + Exonic
1072283680 10:93893684-93893706 GTTCCCAAGCCCTGGCGCCCGGG - Intergenic
1072591626 10:96832723-96832745 CCGCTCCAGGCCCGGCGCCCCGG + Intronic
1072916951 10:99543212-99543234 GCACTCCAGCCCGGGCGACAGGG + Intergenic
1073265625 10:102226679-102226701 GCGCCCCGGCCCCGGGGCCCTGG - Intronic
1073531042 10:104232226-104232248 GCGCTCCCGGCCTTGCGCCATGG + Exonic
1074124089 10:110514514-110514536 GCGCTCCAGCCTGGGCGACAGGG - Intergenic
1074779144 10:116787990-116788012 GAGCTCCCGCCCTGCCGTCCTGG - Intergenic
1075072305 10:119327295-119327317 GCGCTCTCGCCCAGGCACCCAGG - Intronic
1075771110 10:124936987-124937009 GCACTCCAGCCCGGGCGGCCCGG - Intergenic
1076096685 10:127738652-127738674 GGGCTCCAGCGCTGGCGCCTCGG - Exonic
1076587926 10:131561965-131561987 GAGCTTCAGCCCTGGCAGCCTGG + Intergenic
1077074792 11:695442-695464 GCCGTCCAGCCCTGTCGGCCGGG - Exonic
1077184128 11:1228852-1228874 GCCCTCCACCCCTGTCCCCCAGG - Intronic
1077328122 11:1972391-1972413 GCGGGGCAGCCCTGGAGCCCTGG - Intronic
1077371753 11:2185624-2185646 GTCGCCCAGCCCTGGCGCCCAGG - Intergenic
1077411609 11:2406370-2406392 TCCCTCCAGCCCTGGCTCCAGGG - Intronic
1077486441 11:2840861-2840883 TCACTCCAGCCTTGGGGCCCCGG + Intronic
1077864217 11:6209973-6209995 GCCCTCCGGCCCTGCCGACCTGG - Exonic
1078521153 11:12064839-12064861 GCACTCCAGCCTTGGCGACAGGG - Intergenic
1078903615 11:15664151-15664173 GCTCAGCAGCCCTGGCTCCCAGG - Intergenic
1083170601 11:60922074-60922096 GCGTTCCAGCCCTCGCACCTTGG - Exonic
1083913393 11:65724119-65724141 GCGCTCCAGCCTGGGCTACCAGG - Intergenic
1084118718 11:67056733-67056755 GGGCCCCAGCCCAGCCGCCCGGG + Intergenic
1084124043 11:67087015-67087037 GCGCTCCAGCCTGGGCGACAGGG + Intergenic
1084327874 11:68412091-68412113 GAGCACCAGCCCTGGGGTCCCGG - Intronic
1085093393 11:73738612-73738634 GCACTCCAGCCCTGGCAACAGGG + Intronic
1085561054 11:77473493-77473515 GCGCCCCAGCCCTGGCAGCCCGG + Intronic
1086122650 11:83317157-83317179 GCGCCTCTGCCCTGCCGCCCCGG - Intergenic
1086204161 11:84238007-84238029 GCACTCCAGCCCGGGCGACAGGG + Intronic
1087719640 11:101647783-101647805 GCACTCCAGCCCAGGCAACCGGG + Intronic
1090636652 11:128694150-128694172 GCGCGGCCTCCCTGGCGCCCTGG - Exonic
1202811101 11_KI270721v1_random:27571-27593 GCGGGGCAGCCCTGGAGCCCTGG - Intergenic
1092106113 12:5922677-5922699 GCCCTGCAGACCTGGGGCCCGGG + Exonic
1094536140 12:31324389-31324411 GCGCTTCAGCCCTGGCGTCGGGG - Intronic
1096073540 12:48788842-48788864 GCGTTCCAATCCTGGCGCACCGG + Intronic
1096100499 12:48968083-48968105 AAGCCCCAGCCCTGGCCCCCAGG - Exonic
1100461519 12:94804484-94804506 GCGCTCCAGCCTGGGCGACAGGG + Intergenic
1101640817 12:106584707-106584729 CCGCTGCAGCCCTGGTGGCCCGG + Intronic
1102235854 12:111294140-111294162 GCACTCCAGCTCTGTAGCCCAGG - Intronic
1103509748 12:121466676-121466698 GCGCTCCAGCCCCGAAGCCGAGG + Intronic
1104188695 12:126457571-126457593 GCCCTCCAGCACTGGTGCCTGGG + Intergenic
1104841681 12:131828760-131828782 GCGCGGGAGCCCTGGCGCCCTGG + Intronic
1104897488 12:132171486-132171508 GAGCTCCTGGCCTGGCCCCCTGG - Intergenic
1104980126 12:132569968-132569990 GCGCTCCAGGCCTGACACCTTGG - Exonic
1105004318 12:132711324-132711346 GCGCTCCGGCGATGGCACCCAGG - Intronic
1105349503 13:19602444-19602466 GCTGCCCAGCGCTGGCGCCCCGG - Intergenic
1105388914 13:19958311-19958333 TCGCCCGAGCCCGGGCGCCCAGG - Intergenic
1106555584 13:30805702-30805724 CCGCTCCAGCCCTGAGGCTCCGG + Intergenic
1111292133 13:86184706-86184728 GGGCTCCACCCCTGCAGCCCTGG + Intergenic
1111986502 13:95071453-95071475 AAGCTCCAGCCCTGAGGCCCGGG + Intronic
1113013082 13:105793236-105793258 GCACTCCAGCCCGGGCGACGGGG + Intergenic
1113233588 13:108242769-108242791 GCGCTCCAGCCTGGGCGACAGGG - Intergenic
1113473111 13:110561062-110561084 GCGTTCCTGCTCTGCCGCCCTGG - Intronic
1115850736 14:37588152-37588174 GCGCCCCAGCCCGGGCGCCCGGG + Intergenic
1117302303 14:54441472-54441494 GCGCACCAGCCCAGCCGCCCCGG + Intergenic
1117409946 14:55441179-55441201 GCACTCCAGCCTTGGCGACAGGG - Intronic
1117549236 14:56817443-56817465 GTCCTCGAGTCCTGGCGCCCCGG - Intergenic
1118268548 14:64319004-64319026 GCACTCCAGCCCTCCAGCCCTGG + Intronic
1118776830 14:68978747-68978769 GCGCCCCTGCCCCGGAGCCCGGG - Intronic
1120209884 14:81624030-81624052 GCCGGCCAGCCCTGCCGCCCCGG - Intergenic
1121175315 14:91886674-91886696 TCACTCCAGGCCTGGCACCCAGG - Intronic
1121820892 14:96964975-96964997 TTTCTCCAGCCCTGGCACCCTGG + Intergenic
1122651542 14:103229538-103229560 GCTCTCCATCCCTGGCACACAGG + Intergenic
1122719075 14:103712207-103712229 GCGCACCAGGCTTGGCTCCCGGG + Intronic
1122781796 14:104146891-104146913 GTGCTCCAGCCCTGGGATCCTGG + Intronic
1122848676 14:104514712-104514734 GTGGCCCAGCCCTGGGGCCCCGG - Intronic
1124118455 15:26868072-26868094 GCCCACCTGCCCTGGCGCGCCGG + Intronic
1125699717 15:41671356-41671378 GCACTCCAGCCCGGGCGACAGGG - Intronic
1126823733 15:52529161-52529183 GCGCTCCAGCGCTGCCACCGCGG + Intergenic
1127447703 15:59081948-59081970 GCACTCCAGCCTTGACCCCCTGG - Intronic
1127549625 15:60024031-60024053 GCACTCCAGCCTTGGCGGCAGGG + Intronic
1127795182 15:62431909-62431931 GAGCTCCAGGCCTTGGGCCCCGG + Intronic
1128102428 15:65013906-65013928 GCGCTCCAGCCTAGGCGACAGGG + Intronic
1129015663 15:72466186-72466208 GCGCTCCAGCCTGGGCGACAGGG + Intergenic
1130997311 15:88911188-88911210 CCTCTCCAGCCCTTGCCCCCTGG - Intronic
1131367376 15:91852802-91852824 GCGCTCCAGCAGCGGGGCCCTGG + Intergenic
1132634552 16:936942-936964 GATCTCCCGCCCTGTCGCCCAGG - Intronic
1132655065 16:1038403-1038425 CTGCTCCAGCCCTGGCTCCTGGG + Intergenic
1132753128 16:1468135-1468157 GCCTCCCAGGCCTGGCGCCCAGG - Intronic
1132768090 16:1545152-1545174 GGCCTCCAGCCCTGTCCCCCGGG - Intronic
1133008969 16:2899707-2899729 GAGTTCCTGCCCTGGCCCCCTGG + Intergenic
1136027662 16:27480164-27480186 GCACTCCAGCCCGGGGGGCCGGG + Intronic
1136505195 16:30698588-30698610 GCGCACCGGCCCCGGGGCCCCGG - Intronic
1136565381 16:31066520-31066542 GCGCTCCAGCCTGGGCAACCTGG + Intronic
1137343006 16:47628495-47628517 GCGCTCCAGCCTGGGCGACAGGG + Intronic
1137596270 16:49726076-49726098 GTGCTCCAGCCCCGGGGACCTGG + Intronic
1137707870 16:50548168-50548190 GAGCTCCAGGGCTGGCGACCCGG - Intergenic
1138507765 16:57486592-57486614 GCGATTCTGCCCTGGCGCCCTGG + Intronic
1139013273 16:62659367-62659389 GCGCTCCAGCCTGGGCGACAGGG + Intergenic
1139940903 16:70604732-70604754 GAGCTCCCGGCCTGGGGCCCAGG + Intronic
1142395034 16:89827551-89827573 AATCTCCAGCCCTGGAGCCCAGG + Intronic
1142544911 17:694003-694025 GCTCTCCAGCCCTGGCTGGCTGG - Intronic
1142868217 17:2804161-2804183 GGGCTGCAGCCCAGGCTCCCTGG + Intronic
1143153047 17:4818842-4818864 GGGCTCAAGCCCTGGGCCCCTGG + Intronic
1145073072 17:19827873-19827895 GCGCTCCAGCCTAGGCACCAAGG + Intronic
1145231253 17:21174928-21174950 GCGCCCCAACCCTGCCTCCCTGG - Intronic
1145935195 17:28711180-28711202 CCGCTCCCGCCCCGGCGTCCGGG + Intronic
1146956266 17:36937949-36937971 CCGCTCCAGCCCGGGGCCCCGGG + Exonic
1147865011 17:43546191-43546213 CGGCTCCAGCCCAGACGCCCCGG - Exonic
1148113051 17:45157765-45157787 GCGCTCCAGCCTTGGCAACCAGG + Intergenic
1148782652 17:50130292-50130314 CCCCTCCAGCCTCGGCGCCCCGG - Intergenic
1149595332 17:57861819-57861841 CCGCGCCAGGCCTGGGGCCCTGG - Exonic
1150211808 17:63446054-63446076 GCCCTGCAGCCCTCGGGCCCAGG + Exonic
1151313924 17:73310850-73310872 GCTCTCCAGCCCTCCCGGCCGGG + Intronic
1151784583 17:76269254-76269276 GCACTCCAGCCCCTGCCCCCAGG + Intronic
1152080100 17:78181791-78181813 GCACTCCAGCCCGGGCGACAAGG - Intronic
1152197775 17:78927576-78927598 GCCCCCCAACCCTGGAGCCCAGG - Intergenic
1152357824 17:79815210-79815232 ACGCTCCCGCCCGCGCGCCCGGG + Intergenic
1152660988 17:81541840-81541862 GGGCTGCAGCACTGGCTCCCTGG + Intronic
1152861207 17:82697983-82698005 GCGCTCCGCCCCAGGAGCCCCGG + Intronic
1152923024 17:83075137-83075159 GCTCACCAGCCCTGGGGCCATGG + Intergenic
1154139837 18:11813218-11813240 GCACTCCAGCTCTGGCGACAGGG + Intronic
1154360313 18:13655316-13655338 GCCCTGAAGCCCTGGCCCCCGGG - Intergenic
1158453384 18:57586461-57586483 GCGCCCGGGCCCTCGCGCCCGGG - Intronic
1158768392 18:60484578-60484600 GTGCTCCAGTGCTGGTGCCCAGG - Intergenic
1159798226 18:72868205-72868227 GCGCACCAGCCCCGGGGCGCCGG - Intergenic
1159871269 18:73761810-73761832 TCGCTCCAGCCCTGGCCCACAGG - Intergenic
1159915261 18:74182586-74182608 ACCCTCCAGCCCTGGGGCCTGGG + Intergenic
1160147758 18:76378777-76378799 GCGCAGCAGCCCTGGCCCTCCGG + Intronic
1160242107 18:77131991-77132013 GCGCTCCTGCCCCTGCCCCCGGG - Intronic
1160875197 19:1293596-1293618 GCCCTCCAGGCCTGGTGCCCGGG + Intronic
1160880572 19:1318112-1318134 CCACCCCAGCCCTGGCACCCAGG + Intergenic
1160890023 19:1372720-1372742 GCGCTCCAGCCTGGGCGACAGGG + Intronic
1160982949 19:1824818-1824840 GCGCTCCAGCCTGGGCGACAAGG - Intronic
1161159269 19:2752878-2752900 ACACTCCAGGCCAGGCGCCCTGG - Intergenic
1161201338 19:3016553-3016575 GCGCTCCAGCCTGGGCGACAGGG + Intronic
1162549641 19:11351400-11351422 GCACTCCAGCCTGGGCGCCTGGG + Intronic
1162549647 19:11351417-11351439 GCTCTGCCGCCCAGGCGCCCAGG - Intronic
1162739177 19:12764362-12764384 GCGCTCCAGCCTAGGCGACAGGG - Intronic
1162964878 19:14150996-14151018 GCCCGCCAGCCCTGGTGGCCCGG - Exonic
1163386614 19:17003939-17003961 GCGCTCCAGCCTGGGCGACAGGG - Intronic
1163582676 19:18147660-18147682 GCCCACCAGCCCTTGCTCCCAGG - Intronic
1164739290 19:30564626-30564648 GAGCTCCAGCCCGAGCGCCAGGG - Intronic
1165859996 19:38904033-38904055 GCGCTCCAGCCTGGGCGACAGGG + Intronic
1166032575 19:40143802-40143824 GTGCCCTAGCCCAGGCGCCCAGG - Intergenic
1166039217 19:40191896-40191918 GCGCCCCAGCCATGGCCCTCAGG + Exonic
1166187167 19:41148333-41148355 GTGCTCCAGCCCAGGCGCAGTGG + Intergenic
1166628351 19:44382331-44382353 GCACTCCAGCCCAGGCGACAGGG - Exonic
1166930080 19:46297075-46297097 GCGCTGCAGCCCCAGCGCCATGG - Exonic
1167264677 19:48477772-48477794 GCCCTGGCGCCCTGGCGCCCTGG + Intronic
1167643646 19:50694929-50694951 GCTGGCCAGCCCTGGGGCCCCGG - Intronic
1167678478 19:50904388-50904410 GCGCTCTGGCTCTGTCGCCCAGG - Intergenic
1168053153 19:53845276-53845298 GCACTCCAGCCCAGGCGTCAGGG - Intergenic
1168144982 19:54415698-54415720 GGCCCCCAGCCCTGGCCCCCAGG - Intronic
1168714576 19:58519425-58519447 GCACTCGAGACCCGGCGCCCAGG + Intronic
925143162 2:1563868-1563890 AAGCTGCAGCCCTGGCTCCCAGG - Intergenic
927537339 2:23874150-23874172 GCACTCCAGCCTTGGCGACCAGG + Intronic
927714316 2:25342177-25342199 CCGCTCCCGCCGCGGCGCCCCGG - Intronic
927858176 2:26540389-26540411 CCGCTCTAGCCCGGGCTCCCAGG - Intronic
927964849 2:27262434-27262456 GCGCTCCCGCCCTGGGCCCGGGG + Intronic
930007391 2:46909087-46909109 GCTCCTCAGCCCTGGCGCCTGGG + Exonic
930662436 2:54068320-54068342 GCAATCCAGCCCTGAGGCCCAGG - Intronic
931517635 2:63059231-63059253 GCCCTGCAGCCCGGGTGCCCAGG - Intergenic
931724913 2:65100364-65100386 GCACTCCAGCCCAGGCGACAAGG + Intronic
931867326 2:66426525-66426547 GCGCTCCTGCTCCGGCTCCCGGG + Intergenic
932239059 2:70142774-70142796 GCGCAGCCGCCCTGGCGCACGGG - Intergenic
932411496 2:71550506-71550528 GGGCTCCATCCCTGGCCTCCTGG + Intronic
933833024 2:86225715-86225737 TTGCTCCAGCCCTGGTGCCGCGG - Intronic
935592384 2:104855109-104855131 GCCCCCCAGCCCCGGCGCGCTGG - Intergenic
936430182 2:112455965-112455987 GCACTCCAGCCCGGGCGACACGG + Intergenic
937356411 2:121200751-121200773 GCCCTCCAGCCCCGGCTCTCTGG - Intergenic
941275768 2:163488752-163488774 GCACTCCAGCCTTGGCGACCTGG + Intergenic
941987516 2:171523124-171523146 CCGCTGCAGCCCACGCGCCCCGG + Intronic
944154204 2:196593453-196593475 CCGCTCCAGCCGCGGTGCCCCGG + Intronic
945253304 2:207782813-207782835 GCGGGCTAGCCCTGGCACCCTGG - Intergenic
946727049 2:222671499-222671521 GCGCGCCAGCCAATGCGCCCGGG + Intergenic
947792594 2:232876656-232876678 GCACTCCAGCCGTGGTGCACGGG - Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948523867 2:238558652-238558674 GGACACCAGCCCTGGAGCCCTGG - Intergenic
948590362 2:239045715-239045737 GCGCTCCAGCCTGGGCGACAGGG + Intergenic
948859217 2:240744853-240744875 GCACTCAAGGCCTGGCTCCCTGG + Intronic
1168733036 20:103787-103809 GTGCTGCAGCCCTGGGGCACGGG - Intergenic
1169198819 20:3697751-3697773 GAGCTCCAGCCCCTGCCCCCAGG + Intronic
1170612092 20:17922965-17922987 GCACTCCAGCCCTGGCAACAGGG + Intergenic
1170971314 20:21119221-21119243 GCTCTGCAGCCCTGCAGCCCTGG - Intergenic
1171189710 20:23150485-23150507 GGGAGCCAGCCCTGGCGGCCTGG - Intergenic
1172098175 20:32470751-32470773 GCGCTCCCTCCTTGGGGCCCAGG - Intronic
1172113213 20:32559658-32559680 GCATTCCAGTCCTGGCGCCTGGG - Intronic
1172421835 20:34825120-34825142 GCGCTCCAGGCCTGGGGAACAGG - Intronic
1172510466 20:35497469-35497491 GGGCTTCAGCCCTGGCTTCCTGG - Intronic
1172805504 20:37608956-37608978 GCGCTCCAGGCCGGGCGCAGTGG - Intergenic
1173526239 20:43735056-43735078 GCACTCCAGCCCGGGCGACAGGG - Intergenic
1173655957 20:44700519-44700541 GCGCTGCACACCTGCCGCCCAGG + Intergenic
1173672687 20:44809677-44809699 GCGCTCAAGGCCTGGGGCGCCGG + Intronic
1173727793 20:45309080-45309102 GCGCTCCAGGCCAGGAGCCCAGG + Intronic
1173819381 20:46010786-46010808 GCTCTCCCAGCCTGGCGCCCTGG - Intronic
1174451984 20:50626144-50626166 AGGCTCCAGCCCTGGCTCCAAGG + Intronic
1175407662 20:58745390-58745412 GGGCTCCAGACCTGGCCCCTTGG - Intergenic
1175731605 20:61358048-61358070 GCGCTCCTTCCCTGTCGCTCTGG + Intronic
1175914818 20:62420912-62420934 GTGCTCCAGCCCAGGTCCCCAGG - Intronic
1175997907 20:62819594-62819616 GGGCTCCAGGCCTGGCCCCAGGG + Intronic
1176125353 20:63472531-63472553 GGGCCCCAGCCCAGGCCCCCCGG + Exonic
1176159560 20:63641464-63641486 GCGCGCAGGCCGTGGCGCCCTGG + Intronic
1176171535 20:63698508-63698530 CCGCTCCAGCCCGGGCATCCTGG - Exonic
1178358680 21:31930518-31930540 GCCCTCCAGGCTTGGCCCCCTGG + Intronic
1179648727 21:42792804-42792826 GCGCTCCAGCCTGGGCGACAGGG + Intergenic
1179955398 21:44735456-44735478 CCTCTCCAGCCCTGGCAGCCAGG + Intergenic
1180080749 21:45486540-45486562 TACCTCCAGCCCTGGCTCCCGGG - Intronic
1180253346 21:46605073-46605095 GCCCACCAGTCCTGCCGCCCAGG - Exonic
1182475766 22:30575482-30575504 GCGCTCTAGCCGTGTGGCCCTGG + Intergenic
1183102143 22:35590777-35590799 ACCCTCCAGCCCTGGCCCTCAGG - Intergenic
1183314345 22:37128797-37128819 GTCCTTCAGCCCTGGCGGCCTGG - Exonic
1183530403 22:38350383-38350405 GCACTCCAGCCCTCCAGCCCAGG - Intronic
1183546252 22:38455969-38455991 GCCCCCCAGCCCGGGAGCCCCGG + Intergenic
1183617337 22:38953751-38953773 CCACTCCAGCCCTGGCTGCCAGG - Intronic
1183903466 22:41022614-41022636 GACCTGCAGCCCTGGGGCCCGGG - Intergenic
1184339263 22:43877069-43877091 GCCCTGGAGCCCTGGAGCCCTGG - Intergenic
1184458359 22:44624029-44624051 GCGCTAGACCCCTGGGGCCCTGG + Intergenic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
1185335522 22:50269542-50269564 CCCCTCCAGCCCTGGCTACCCGG + Intronic
1185348817 22:50323313-50323335 GCACTCCAGCTCTGTCACCCAGG + Intronic
1185407722 22:50664360-50664382 GCACTCCAGCCCGGGCGACAGGG + Intergenic
950434672 3:12971977-12971999 GCACTCCAGCCCTGGCAACAGGG + Intronic
950787681 3:15449808-15449830 GCCCTCCAGCCTTGGGACCCAGG + Intronic
952165660 3:30746012-30746034 GCACTCCAGCTCTGTTGCCCAGG + Intronic
952484694 3:33798558-33798580 GAGCTCCAGCGCAGGCGCACTGG - Exonic
953593610 3:44285602-44285624 GCACTCCAGCCTGGGCGACCGGG - Intronic
953882916 3:46700920-46700942 GCTCTCCAGCTCTGGTGTCCAGG + Intergenic
954304659 3:49719230-49719252 GCGCTCCAGCGCCTGCGCCCCGG - Exonic
956183320 3:66537922-66537944 GTGCTCCCACCCTGGCGTCCAGG - Intergenic
956771139 3:72527018-72527040 GCGCTCCAGCCTGGGCGACAGGG - Intergenic
956808452 3:72840524-72840546 GCACTCCAGCCTTGGCGACAGGG + Intronic
959567597 3:107848608-107848630 CCACTCCACCCCTGCCGCCCAGG - Intergenic
961182345 3:124886930-124886952 GCGCTCCTGCCCCGGCTCGCAGG - Exonic
961558458 3:127712569-127712591 GCCCTCCAGCCTTGGCATCCAGG + Intronic
964091725 3:152885199-152885221 GCCCTGGAGCCCTGGAGCCCTGG + Intergenic
966684835 3:182682738-182682760 GCGCGCCGGCCCGGGAGCCCGGG + Intergenic
966874520 3:184314761-184314783 GCGCCGCCGCCCCGGCGCCCTGG + Intronic
968548794 4:1212207-1212229 GCTCTCCAGCCTCGGCGCCTGGG - Exonic
968909336 4:3469568-3469590 GCCCTCTGGGCCTGGCGCCCGGG + Intronic
969021535 4:4142977-4142999 GCGCTCCGTCCCCGGCGGCCTGG + Intergenic
969307790 4:6335668-6335690 GCTCTGCAGCCCTGGCCCACCGG - Intronic
969417354 4:7069168-7069190 GGGCTCCAGCCCTGGGATCCCGG - Intergenic
969520570 4:7675662-7675684 GGGCTCCAGCCCTCACCCCCTGG + Intronic
969732331 4:8964440-8964462 GCGCTCCATCCCCGGCGGCCTGG - Intergenic
969867234 4:10083932-10083954 GAGCTCCAGCCCTGGCTCTGTGG + Intronic
969990749 4:11260070-11260092 GCTCTCCAACCCTGGTTCCCTGG + Intergenic
972352702 4:38251726-38251748 GGGCTACAGCCCTGGCTACCTGG + Intergenic
972619034 4:40729037-40729059 GCACTCCAGCCTGGGCGCCTGGG + Intergenic
973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG + Exonic
976765412 4:88592902-88592924 GCCCTCCCGCCCTGCCGCCCGGG + Intronic
982059098 4:151585200-151585222 GCACTCCAGCTCTGTCGGCCAGG + Intronic
984734613 4:183098456-183098478 GCGCTCCAGCCGCGGGGCCCCGG - Intergenic
985282703 4:188302799-188302821 GCACTCCAGCCTTGGCGACAGGG - Intergenic
985688935 5:1296051-1296073 CCCCTCCAGACCTGGGGCCCCGG + Intergenic
988684348 5:33513276-33513298 ATGCTCCAGCCCTGAAGCCCAGG - Intergenic
995023881 5:107397214-107397236 GCACTCCAGCCCTGTCGGCAGGG + Intronic
996457764 5:123704202-123704224 GCACTCCAGCCTTGGCGACAGGG + Intergenic
997515150 5:134482944-134482966 GCACTCCAGCCCGGGCGACAGGG - Intergenic
997515259 5:134483745-134483767 GCACTCCAGCCCGGGCGACAGGG - Intergenic
998224779 5:140318532-140318554 GCACTCCAGCCCAGGCGACAGGG - Intergenic
999244709 5:150147649-150147671 GCCCTCCTGCTCTGCCGCCCAGG - Intronic
1002135627 5:177105847-177105869 GGGCCCCAGCCGTGGGGCCCAGG - Intergenic
1002442336 5:179270935-179270957 TAGCTCCAGGCCTGGGGCCCAGG - Intronic
1003107916 6:3229397-3229419 GAGCTCCAGTCTGGGCGCCCTGG - Intronic
1006670678 6:35728097-35728119 GTGTTCCAGCCCCGGCGCGCTGG - Intronic
1006808627 6:36805642-36805664 CCGTCCCAGCCCTGGGGCCCAGG - Intronic
1007107877 6:39295794-39295816 ACACTCCAGGCCTGGAGCCCAGG + Intergenic
1007555404 6:42761421-42761443 GCACTCCAGCTCTGCTGCCCAGG - Intronic
1011624459 6:89271801-89271823 CTGCTCCAGTCCTGGCTCCCCGG - Intronic
1013009575 6:106107137-106107159 GCGCTGCGGCCCCGGCGCCTGGG + Exonic
1013621354 6:111893120-111893142 GCACTCCAGCCTGGGCGACCAGG - Intergenic
1013774140 6:113660562-113660584 GCACTCCAGCCCTGGTGACAGGG - Intergenic
1016936922 6:149454616-149454638 GGGCGCCTGCCCTGGTGCCCCGG - Intronic
1017163850 6:151390519-151390541 GCGCAACAGCCCCGGCGCCGGGG + Intronic
1018400239 6:163414362-163414384 GCGACCCAGTCCTTGCGCCCAGG + Intronic
1018638552 6:165886207-165886229 GCCCTGCAGCCCTGGAGCCCTGG + Intronic
1018638579 6:165886286-165886308 GTCCTGCAGCCCTGGAGCCCTGG + Intronic
1018769059 6:166956394-166956416 CCGCAGCAGCCCTGGCGACCCGG + Exonic
1019109929 6:169701827-169701849 GCGCTCCAGCCCTGCGCCCTAGG + Intronic
1021426394 7:20504532-20504554 GCACTCCAGCCCAGGCGGCAGGG - Intergenic
1021600210 7:22356943-22356965 GCGCCGCAGCCCCAGCGCCCGGG - Intronic
1022898851 7:34781725-34781747 AAGCTCCAGCCCTGGAGCCATGG + Intronic
1022923293 7:35037269-35037291 GCGCTCGGGCCCCGGCTCCCCGG + Intronic
1023474730 7:40564339-40564361 GCACTCCAGCCTGGGCGACCTGG + Intronic
1023830144 7:44034482-44034504 GCTCTCCAGGCCATGCGCCCGGG - Intergenic
1025217648 7:57071857-57071879 GCGCTCCAGCCTGGGCGACCGGG + Intergenic
1025230937 7:57203045-57203067 GCGCTCCAGCCTGGGCGACAGGG + Intergenic
1025653703 7:63498605-63498627 GCGCTCCAGCCTGGGCGACCGGG - Intergenic
1026410031 7:70110904-70110926 GCGCTCCAGCCTGGGCGACTGGG - Intronic
1026828449 7:73597558-73597580 GGGCTCCAGGCCTGGCACCTTGG + Exonic
1026977109 7:74505588-74505610 GCCATCTAGCCCTGGCCCCCCGG - Intronic
1027265840 7:76494856-76494878 GCTCTCCAGCTCTGGCTCCGGGG - Intronic
1027317212 7:76992973-76992995 GCTCTCCAGCTCTGGCTCCGGGG - Intergenic
1029114943 7:98231999-98232021 GCCCTCCTCCCCTGGCACCCCGG - Intronic
1029436288 7:100565789-100565811 CCCCTCCAGCCCTGGAGCTCCGG - Exonic
1029597133 7:101543922-101543944 TGGCTCCAGGCCTGGCCCCCTGG - Intronic
1029740462 7:102488769-102488791 GCTCTCCAGGCCATGCGCCCGGG - Intronic
1029758458 7:102587941-102587963 GCTCTCCAGGCCATGCGCCCGGG - Intronic
1029776396 7:102687020-102687042 GCTCTCCAGGCCATGCGCCCGGG - Intergenic
1032031114 7:128484625-128484647 GCACTCCAGCCCGGGCGACAGGG - Intronic
1033839940 7:145360898-145360920 GCCAGCCAGCCCTGCCGCCCCGG - Intergenic
1034441026 7:151086265-151086287 GCGCTCCAGCCCTGGCGCCCCGG - Intronic
1034621600 7:152461387-152461409 GCACTCCAGCCTTGGAGCCTTGG + Intergenic
1034983163 7:155491107-155491129 GGGCTCCACCCCCCGCGCCCTGG + Intronic
1035123062 7:156585199-156585221 GGGCTCCTGCCCTGCAGCCCCGG - Intergenic
1035295150 7:157863064-157863086 GTGCTCCGGCTCTGGGGCCCTGG + Intronic
1035664670 8:1372171-1372193 GCGCCCCAGCGTTGGCGCCACGG - Intergenic
1036453087 8:8885742-8885764 GCGCTCCAGCCTGGGCGACAGGG - Intronic
1036465092 8:8989837-8989859 GCACTCCAGCCTGGGCGGCCTGG - Intergenic
1036691894 8:10949445-10949467 GAGCTCCAGCCCTGGCTCTGTGG - Intronic
1038204948 8:25457866-25457888 GCGCGACCGCCCGGGCGCCCAGG + Intronic
1038461959 8:27724621-27724643 GCACTCCAGCCCTGGCGACAGGG + Intergenic
1039010264 8:33086044-33086066 GCACTCCAGACCTGGCTCTCTGG - Intergenic
1039918425 8:41876232-41876254 GCGCTCCAGCCGCGGCACCCTGG + Intronic
1044988681 8:97776342-97776364 GCACTCGACCCTTGGCGCCCAGG + Intronic
1045196587 8:99937738-99937760 GCACTCTAGCCCTGGTGACCGGG + Intergenic
1049102355 8:140588769-140588791 GCCCGCCAGCCCTGGGCCCCGGG - Intronic
1049431375 8:142566853-142566875 GCGCTGCTGCCCTGGCAGCCTGG + Intergenic
1049655855 8:143796968-143796990 ACCCTCCAGCTCTGGCCCCCAGG + Intronic
1049713789 8:144079945-144079967 GGGCTCGAGCCCGGGAGCCCCGG - Exonic
1049777958 8:144415147-144415169 GGGCTCCGGCCCTGCCCCCCAGG + Intronic
1049778994 8:144418989-144419011 GCACTCCAGCCCGGGCAACCTGG + Intergenic
1052349697 9:27445930-27445952 GCTCTCCAGTCCTGACGACCTGG + Intronic
1052805494 9:33009742-33009764 GCACTCCAGCCCTCCAGCCCAGG + Intronic
1053067308 9:35077798-35077820 GCACTCCAGCCCTGCAGCCTGGG - Intronic
1053130035 9:35609486-35609508 CCGCTCCAGGGCTGCCGCCCGGG - Exonic
1053226153 9:36359769-36359791 AGGCTCCAGCCTTGTCGCCCAGG + Intronic
1057179315 9:93021354-93021376 GGGCTGCAGCCCTGACTCCCTGG - Intronic
1057296894 9:93851650-93851672 CTGCTCCAGCCCTGTGGCCCAGG + Intergenic
1057631203 9:96720190-96720212 GCTCTGGAGCCCTGGAGCCCTGG + Intergenic
1059349395 9:113653900-113653922 GCACCCCTGCCCTGGCCCCCAGG + Intergenic
1060821747 9:126665296-126665318 CCGCCCCAGCCCTGGCTCCAGGG - Intronic
1060979858 9:127785820-127785842 GAGCCCCAGCTCCGGCGCCCCGG + Intronic
1061896995 9:133653391-133653413 GTGCTCCAGGCCTGTCTCCCTGG - Intronic
1062162160 9:135086794-135086816 GCGCTCGAGTCATGGCGCCCAGG - Intronic
1062277067 9:135736231-135736253 GCGGACCAGGCCTGGCGCTCAGG - Intronic
1062595008 9:137295581-137295603 GGGCTCCGGCCCTTGCGCCCGGG + Intergenic
1188382537 X:29514481-29514503 GCACTCCAGCCTTGGCGACAGGG - Intronic
1190485319 X:50917891-50917913 ACGCTCCAGCCCTGCCCCTCAGG - Intergenic
1192111718 X:68371777-68371799 GCACTCCAGCCCGGCAGCCCGGG - Intronic
1192447946 X:71224496-71224518 GCGCCGCAGCCCTGGCACCGGGG + Exonic
1193362083 X:80590693-80590715 GCGCTCCAGCCTGGGCACCATGG - Intergenic
1199662178 X:150063054-150063076 ACGTTCCAGCCCTGGCAGCCAGG + Intergenic
1200215119 X:154364885-154364907 GCCCTCCAGCCCAGGGCCCCAGG + Exonic