ID: 1034445306

View in Genome Browser
Species Human (GRCh38)
Location 7:151111065-151111087
Sequence GTCCAGCAGGCTCTCCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034445306_1034445310 -6 Left 1034445306 7:151111065-151111087 CCAACTTGGAGAGCCTGCTGGAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1034445310 7:151111082-151111104 CTGGACACCAGCCAGTCCTGGGG 0: 1
1: 0
2: 3
3: 23
4: 258
1034445306_1034445312 -4 Left 1034445306 7:151111065-151111087 CCAACTTGGAGAGCCTGCTGGAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1034445312 7:151111084-151111106 GGACACCAGCCAGTCCTGGGGGG No data
1034445306_1034445315 3 Left 1034445306 7:151111065-151111087 CCAACTTGGAGAGCCTGCTGGAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1034445315 7:151111091-151111113 AGCCAGTCCTGGGGGGCGAAGGG No data
1034445306_1034445316 4 Left 1034445306 7:151111065-151111087 CCAACTTGGAGAGCCTGCTGGAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1034445316 7:151111092-151111114 GCCAGTCCTGGGGGGCGAAGGGG No data
1034445306_1034445308 -8 Left 1034445306 7:151111065-151111087 CCAACTTGGAGAGCCTGCTGGAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1034445308 7:151111080-151111102 TGCTGGACACCAGCCAGTCCTGG No data
1034445306_1034445319 10 Left 1034445306 7:151111065-151111087 CCAACTTGGAGAGCCTGCTGGAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1034445319 7:151111098-151111120 CCTGGGGGGCGAAGGGGTCTTGG No data
1034445306_1034445309 -7 Left 1034445306 7:151111065-151111087 CCAACTTGGAGAGCCTGCTGGAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1034445309 7:151111081-151111103 GCTGGACACCAGCCAGTCCTGGG 0: 1
1: 0
2: 2
3: 19
4: 247
1034445306_1034445314 2 Left 1034445306 7:151111065-151111087 CCAACTTGGAGAGCCTGCTGGAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1034445314 7:151111090-151111112 CAGCCAGTCCTGGGGGGCGAAGG 0: 1
1: 0
2: 1
3: 23
4: 249
1034445306_1034445311 -5 Left 1034445306 7:151111065-151111087 CCAACTTGGAGAGCCTGCTGGAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1034445311 7:151111083-151111105 TGGACACCAGCCAGTCCTGGGGG 0: 1
1: 0
2: 3
3: 30
4: 343
1034445306_1034445320 15 Left 1034445306 7:151111065-151111087 CCAACTTGGAGAGCCTGCTGGAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1034445320 7:151111103-151111125 GGGGCGAAGGGGTCTTGGTGTGG 0: 1
1: 0
2: 1
3: 17
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034445306 Original CRISPR GTCCAGCAGGCTCTCCAAGT TGG (reversed) Intronic
901654560 1:10762032-10762054 GCCCTGCAGGTTCTCCAACTTGG + Intronic
902449641 1:16488728-16488750 GAGCAGCAGGCGCTCCAAGCAGG - Intergenic
902504841 1:16932614-16932636 GAGCAGCAGGCGCTCCAAGCAGG + Intronic
902583346 1:17423169-17423191 GTCTTGCAGGCACTCTAAGTGGG - Intronic
902876107 1:19341868-19341890 GTGCAGCAGACTTTCCAAGGTGG - Intronic
904472142 1:30742471-30742493 GTCCTGCAAGCTCTCCCAGATGG - Exonic
907382672 1:54104229-54104251 GAACAGGAGGCACTCCAAGTGGG - Intronic
909983715 1:82135504-82135526 CTGCAGCATGCTTTCCAAGTTGG + Intergenic
912381955 1:109252475-109252497 GTTCACCAGGATCTCCAGGTAGG - Exonic
914806429 1:150995390-150995412 GACCAGCTGGGCCTCCAAGTAGG + Exonic
915673497 1:157509953-157509975 GTCCACCTGTGTCTCCAAGTGGG - Intergenic
919847087 1:201649073-201649095 GTCCAAGACGCTGTCCAAGTCGG + Exonic
919887602 1:201946275-201946297 CTCCAGCAGGCTGTCGATGTCGG + Exonic
920220772 1:204398695-204398717 GTCCATCAGGCACTCCCAGATGG + Intergenic
920948476 1:210551471-210551493 GCCCAGCAGGCTGTCCTAGGGGG - Intronic
922969912 1:229727642-229727664 GTCCCACAGGCTCTCCAGGTTGG - Intergenic
1062972447 10:1659627-1659649 GTTCACCAGGCTCTGAAAGTTGG - Intronic
1065742111 10:28806312-28806334 GTCTAGCAGTCTCTTTAAGTCGG + Intergenic
1069928078 10:71865185-71865207 GCCCAGCAGGATCTCACAGTTGG - Intergenic
1070917715 10:80165466-80165488 GACCAGCAGGGTCTCCAAACGGG - Intronic
1071094100 10:81952991-81953013 CTGCAGCAGGCCCTGCAAGTTGG + Intronic
1078306048 11:10187360-10187382 TTTCAGCAAGCCCTCCAAGTAGG - Intronic
1078934112 11:15937346-15937368 ATCCAGCAGACTTTACAAGTGGG + Intergenic
1083609070 11:63996606-63996628 ATCCAGCAGTGCCTCCAAGTGGG - Exonic
1083810586 11:65103633-65103655 TTCCAGCTGTCTCCCCAAGTGGG + Intronic
1084523029 11:69675987-69676009 GGCCAGGAGGCTCTGCATGTGGG + Intergenic
1097168735 12:57100076-57100098 GCCCAGCAGGATCTCCTAGGGGG + Exonic
1102349723 12:112183627-112183649 TCCCAGCAGGCTCTGCAAGGAGG - Intronic
1102429919 12:112875239-112875261 GCCCAGCATGCTCTGCAAGCAGG - Intronic
1103682114 12:122702414-122702436 GTCCAGCATGCTGTTCATGTAGG + Exonic
1103683857 12:122715868-122715890 GTCCAGCATGCTGTTCATGTAGG + Exonic
1104984504 12:132589068-132589090 GTCCAACAGGCTCTACACGCTGG + Intergenic
1107991092 13:45819792-45819814 GTCCTGCAGGCCCTGGAAGTGGG - Intronic
1118780942 14:69007175-69007197 GTCCAGCAAGCAGTCAAAGTTGG + Intergenic
1122645342 14:103189809-103189831 CTCCAGCAGGCTCTTCCACTCGG + Intergenic
1123033446 14:105461862-105461884 GGCCAGCGGCCTCTCCAAGGCGG + Intronic
1202846878 14_GL000009v2_random:185842-185864 CACCATCAGGCACTCCAAGTTGG + Intergenic
1202916336 14_GL000194v1_random:176443-176465 CACCATCAGGCACTCCAAGTTGG + Intergenic
1202876443 14_KI270722v1_random:6667-6689 CACCATCAGGCACTCCAAGTTGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1124380372 15:29160194-29160216 GGCCAGCAGGAGTTCCAAGTGGG - Intronic
1124999303 15:34754453-34754475 TTCTAGCAGCCTCTCCAAGATGG + Exonic
1128094720 15:64944964-64944986 GTCCAGCAGTATCTCCACGCTGG - Intronic
1128497398 15:68206275-68206297 GTCTATGAGGCTCTACAAGTAGG + Intronic
1129799376 15:78402066-78402088 GTCCATGAGGCTCTGCATGTGGG - Intergenic
1131890091 15:96963358-96963380 CTTCACCAGGCTCTCCAAGATGG - Intergenic
1133296224 16:4753791-4753813 GGCCAGATGGCTCTCCACGTGGG - Intronic
1134814964 16:17198280-17198302 GTCCCGCATGCTCTGCAGGTAGG + Exonic
1135423308 16:22318844-22318866 GCCCAGGAGGCTCATCAAGTTGG - Exonic
1136390809 16:29963101-29963123 TTCCAGCAGGCTCTCCCCGGAGG + Exonic
1137861411 16:51850489-51850511 TTCCAGCAGCCTCTGAAAGTAGG + Intergenic
1139377608 16:66509946-66509968 GTCCAGCCTCCTCTCCAAGGTGG + Exonic
1139725532 16:68894531-68894553 GTCCTGCAAGCTCTGCAAGCTGG - Intronic
1140488882 16:75317452-75317474 GGCCAGGGGGCTCTCCAAGGAGG + Intronic
1140802875 16:78505374-78505396 GTCCACCAGGCCCTCTGAGTGGG + Intronic
1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG + Intergenic
1142501877 17:337594-337616 GTCCAGGAGGCACCCCAACTTGG + Intronic
1147636208 17:41966043-41966065 GTAAATCAGGCTCTCCAAGCTGG + Intergenic
1149465229 17:56873229-56873251 GTCTCGGAGGCCCTCCAAGTTGG - Intergenic
1149465505 17:56875660-56875682 GTCTCGGAGGCCCTCCAAGTTGG - Intergenic
1152616091 17:81338570-81338592 GCCCAGAAGCCTCTCCAGGTGGG - Intergenic
1158652288 18:59298982-59299004 GTCCTCCAGGCTCTCCAAGGAGG - Intronic
1160967688 19:1753805-1753827 GTCCAGCAGGCTCGCCATGCCGG - Exonic
1161316287 19:3619089-3619111 CTCCAGCAGGTCCTCCATGTCGG + Exonic
1161329956 19:3681975-3681997 GTGCAGCAGGCTCTGCAATCTGG - Intronic
1163424285 19:17232580-17232602 CTCCTGCAGGCTCTCAACGTGGG + Exonic
1164896938 19:31885176-31885198 CTCCTGCAGGCTCTCCAAGAAGG + Intergenic
1165026842 19:32968587-32968609 GTCCAGCAGGTCCTCCAAAAAGG + Intronic
1165397326 19:35571834-35571856 GTGCAGTAGGCTCTCCATTTAGG - Intergenic
1165832122 19:38735497-38735519 GACCTGCAGTCTCTCCAGGTGGG - Exonic
1167019339 19:46861935-46861957 GTGCAGCAGGCTCTGCGAGAGGG - Intergenic
1167324587 19:48816266-48816288 CCCTAGCAGGCTCTCCGAGTGGG + Intronic
1202674223 1_KI270710v1_random:26147-26169 CACCATCAGGCACTCCAAGTTGG + Intergenic
926662847 2:15487411-15487433 GTCCAGCAGGGTCTTCTAGGGGG - Intronic
927690237 2:25203110-25203132 GTGCCTCAGCCTCTCCAAGTAGG + Intergenic
928533340 2:32215158-32215180 GTCCAGCAGACACTCCATGTTGG - Intronic
930375554 2:50561472-50561494 GGCTAGAAGGCTATCCAAGTTGG + Intronic
932213284 2:69948926-69948948 GCCAGGCAGGCTCCCCAAGTGGG - Intergenic
934949191 2:98564734-98564756 GCTCAGCAGGCTCTCGAACTGGG - Exonic
936671139 2:114658307-114658329 GTCCAGCAGGCTGACAAATTGGG + Intronic
939472852 2:142646638-142646660 GTCCAGCAGGCTCATTAACTAGG + Intergenic
947629507 2:231642972-231642994 GGCCAGCAGGCTCTCCAGGCGGG - Intergenic
948552438 2:238782946-238782968 GCCCAGCAGACTCTCTGAGTTGG - Intergenic
948886673 2:240888295-240888317 GTCCAGCAGGACGTCGAAGTAGG + Exonic
1169406510 20:5325748-5325770 GGCAGGCAGGCTCTCCAAGAAGG + Intergenic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175644486 20:60659187-60659209 GTCCAGCAGGGTCTCCGGTTTGG - Intergenic
1176635689 21:9191089-9191111 CACCATCAGGCACTCCAAGTTGG + Intergenic
1176637706 21:9264037-9264059 CACCATCAGGCACTCCAAGTTGG - Intergenic
1176717749 21:10367895-10367917 CCCCAGCCTGCTCTCCAAGTGGG + Intergenic
1179508479 21:41857202-41857224 GTCCAGGAGGGTCGCCAAATGGG - Exonic
1179547894 21:42124653-42124675 GGCCAGAAGGCTCTCCTAATGGG + Intronic
1180298976 22:11020801-11020823 CCCCAGCCTGCTCTCCAAGTGGG + Intergenic
1180371260 22:12039368-12039390 CACCATCAGGCACTCCAAGTTGG + Intergenic
1180421749 22:12871534-12871556 CACCATCAGGCACTCCAAGTTGG - Intergenic
1180963418 22:19773253-19773275 GCCCTGCAGGCTCTCCCAGGAGG - Intronic
1183331218 22:37222679-37222701 TCCCAGCAGCCACTCCAAGTGGG - Intergenic
1184094209 22:42307853-42307875 GTCCAGCTGGCCGTCCAAGCTGG - Intronic
949154033 3:807796-807818 GTTCTGCAGGCTATACAAGTGGG - Intergenic
950853938 3:16088152-16088174 GTGTAGCAGGCTCTCCAGGCAGG + Intergenic
951649319 3:24932069-24932091 TCCAAGCAGGCTCCCCAAGTTGG - Intergenic
953026521 3:39148294-39148316 GACCAGCAGGTTCTCCCAGGAGG + Intronic
955797314 3:62650973-62650995 TACCGGCATGCTCTCCAAGTTGG + Exonic
962201701 3:133405436-133405458 TTCCAGCATGTTCTTCAAGTAGG - Intronic
965556738 3:170026186-170026208 GTTGAGCAAGCTGTCCAAGTAGG - Intergenic
965658921 3:171020309-171020331 GTGTAACAGGCTCTCCAAGTAGG - Intronic
966842786 3:184103177-184103199 ATCAAGCAGGCTTTTCAAGTTGG - Intronic
1202749189 3_GL000221v1_random:140984-141006 CACCATCAGGCACTCCAAGTTGG + Intergenic
969713923 4:8859510-8859532 TTCCAGCGGGCTCTCCACATGGG - Intronic
970117629 4:12716993-12717015 ATGCAGCAGGATCTCAAAGTGGG - Intergenic
970298531 4:14657555-14657577 GTTCTGCAGGCTCTTCAAGCAGG - Intergenic
971252723 4:24986656-24986678 GAACAGCAGGCATTCCAAGTGGG - Intergenic
974708752 4:65559602-65559624 AACCAGCAGGCTCTTTAAGTAGG + Intronic
981721486 4:147806196-147806218 GTCCAGGCGGCTTTCCAGGTCGG + Intronic
986624961 5:9715368-9715390 GTCCAGCAGGCTGCCCAATTGGG - Intergenic
986905360 5:12488692-12488714 GTGTGGCAGGCTCTCCAAGAAGG - Intergenic
990301772 5:54455995-54456017 GTCCAGCAGGATCTGAAAGTGGG - Exonic
990633958 5:57702215-57702237 GTGAAGCAGCCTCTCCAATTTGG + Intergenic
992781526 5:80132495-80132517 GTCCAGGAGGTGCTCCAGGTTGG - Intronic
993902409 5:93593586-93593608 CTCCTGCAGGCTCTCGATGTGGG - Exonic
998512431 5:142724677-142724699 GTGTAGCTGACTCTCCAAGTGGG + Intergenic
1000999338 5:167990904-167990926 GGCTAGCAGGCTTTCCCAGTGGG - Intronic
1012565060 6:100638666-100638688 ATCCAGTAGGTGCTCCAAGTAGG + Exonic
1018624183 6:165761428-165761450 GTCCAGCAGCCCCTCCATGCGGG + Intronic
1022021080 7:26399480-26399502 GACCAGGATGTTCTCCAAGTGGG + Intergenic
1032396171 7:131591699-131591721 CTCCAGCAGTCTTTCCCAGTGGG - Intergenic
1034445306 7:151111065-151111087 GTCCAGCAGGCTCTCCAAGTTGG - Intronic
1034932937 7:155177799-155177821 GTCAAGCAGACCCTCCAGGTTGG - Intergenic
1039951384 8:42175523-42175545 GCCCAGCAGGGCCTCAAAGTTGG - Exonic
1041742917 8:61176263-61176285 CTCCAGCAGCCTCTCCCAGGTGG - Intronic
1045411940 8:101929004-101929026 ATCCAGAAGGCCTTCCAAGTGGG + Intronic
1049765296 8:144352617-144352639 TTCCAGCAGGCACAGCAAGTGGG + Intronic
1056193326 9:84205958-84205980 GTCCAGCAGACCCCCCAAGGCGG - Intergenic
1056272929 9:84964638-84964660 GTCCAACAAGCTCCCTAAGTTGG - Intronic
1056718928 9:89056958-89056980 GTCCATCAGCCTCTCCAGGGTGG + Intronic
1061953850 9:133951404-133951426 CTCCAGCAGGAGCTCCAAATGGG - Intronic
1062028855 9:134352965-134352987 CCCCAGCTGGCTTTCCAAGTGGG - Intronic
1203758466 Un_GL000218v1:158397-158419 CACCATCAGGCACTCCAAGTTGG + Intergenic
1203717825 Un_KI270742v1:171074-171096 CACCATCAGGCACTCCAAGTTGG + Intergenic
1203652049 Un_KI270751v1:134660-134682 CACCATCAGGCACTCCAAGTTGG + Intergenic
1185848010 X:3457853-3457875 TTCCAGCAGGCTCTGGAAGCTGG - Intergenic
1187669894 X:21657534-21657556 GTCCAGCAGGCGCTGCAGGCCGG + Exonic
1188589199 X:31813731-31813753 TTCCAGCCTGCTCTGCAAGTGGG + Intronic
1189947026 X:46189777-46189799 CTCCAGCATGCTCTTCAAATAGG + Intergenic
1190265160 X:48823707-48823729 CTCCAGCTGCCTCTCCTAGTAGG - Exonic
1190266270 X:48829070-48829092 GGGCAGCAGGCTCTGCAAGTGGG - Exonic
1190456702 X:50634566-50634588 GTCCATCAGCCTCTCCATGTGGG + Exonic
1191844175 X:65534198-65534220 CTCCGGCATCCTCTCCAAGTTGG + Intronic
1195532017 X:105968427-105968449 ATCCAGCTGCCTCCCCAAGTGGG + Intergenic
1196835908 X:119813505-119813527 GTTCTGCAGGCTGTACAAGTCGG - Intergenic
1198721737 X:139629145-139629167 GTCCAGTAGGCTATCCATCTAGG - Intronic
1201171985 Y:11275934-11275956 CACCATCAGGCACTCCAAGTTGG + Intergenic