ID: 1034449088

View in Genome Browser
Species Human (GRCh38)
Location 7:151127907-151127929
Sequence AGGAGCCTGCCCCGGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 9, 3: 25, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034449088 Original CRISPR AGGAGCCTGCCCCGGGGACA GGG (reversed) Intronic
900403523 1:2482630-2482652 AGGGCTCTGCCCTGGGGACAGGG + Intronic
900511230 1:3062093-3062115 TGGGGCCTGCCCTGGGGACTGGG - Intergenic
900632781 1:3645878-3645900 AGGAGCCTGGCCTGGGGGCGTGG - Intronic
901138050 1:7010262-7010284 AGGAGCCGGCCCTGGGGTCCTGG - Intronic
901435432 1:9244714-9244736 GGGAGCCTGCCCTGTAGACAGGG - Intronic
901633339 1:10658471-10658493 AGGAGCCTGCCGTGGAGAGAAGG - Intronic
902571509 1:17349964-17349986 AGCAGCCAGCCCCGTGAACAGGG - Intronic
903225657 1:21893090-21893112 AGTAGCCTGCTCCGGGGCCAGGG - Intronic
904131937 1:28281780-28281802 TGGACCCTGCCCCTGGGCCATGG + Exonic
905137089 1:35808242-35808264 CGGCGCCCGGCCCGGGGACAGGG - Exonic
905318437 1:37098322-37098344 AGGGGCCTGCCCTGGGGCCAAGG + Intergenic
908322434 1:62991383-62991405 AGGAGCCTCCCCCAGGTGCAAGG - Intergenic
910251177 1:85200855-85200877 CCGAGCCTGCCCCCGGGACGGGG - Exonic
914857150 1:151361039-151361061 AGGAGGCTTCCCAGAGGACAAGG + Intergenic
915265741 1:154716056-154716078 AGGAGCCAGCCCTGGGGAAGAGG - Intronic
915564191 1:156704905-156704927 ATGAGCCTGCCCTGGGGATTGGG + Intronic
915595405 1:156893891-156893913 ACCACCCTGCCCCGGGGAAAGGG + Intronic
915636949 1:157194197-157194219 GTGACCCTGCCCCGAGGACACGG - Intergenic
917530352 1:175829476-175829498 AGTAGCCTTGCCAGGGGACAAGG - Intergenic
920121824 1:203664637-203664659 AGGAGCCTGGCCCGGGTGCAGGG + Intronic
920451179 1:206062361-206062383 AGGAGCCTGCCTCTGGGGCTGGG - Intronic
920563033 1:206952650-206952672 AGGAGCCTGCCGTGGGGAGCGGG + Intergenic
922475936 1:225907075-225907097 AGGAGCCTACTCCGTGGGCATGG - Intronic
922668982 1:227494761-227494783 TGGCACCTGCCACGGGGACAGGG - Intergenic
922670615 1:227506541-227506563 TGGCACCTGCCACGGGGACAGGG + Intergenic
1062983387 10:1744456-1744478 GGGAGCTTTCCCCAGGGACAGGG - Intergenic
1064007734 10:11711989-11712011 AGAAGCCTGCCCTGGTGATATGG + Intergenic
1064092512 10:12396794-12396816 AGGAGCCTGCCCAGTGGACGTGG - Intronic
1066712664 10:38252433-38252455 CTGAGGCTGCCCTGGGGACAAGG - Intergenic
1068083279 10:52346557-52346579 AGTTGGCTGCCTCGGGGACACGG - Intergenic
1069686522 10:70322526-70322548 AGGAGCCTGCCCAGAGCAGAAGG - Intronic
1069944894 10:71978979-71979001 AGGAACCTGTCCCAGGGCCAAGG - Intronic
1069994371 10:72333510-72333532 AGGAGGCTGCCCTGGGGTCCCGG + Exonic
1070129699 10:73647846-73647868 AGGCGCCTGCCCCAGGCCCAGGG - Exonic
1070794127 10:79207157-79207179 ATGAGCCTGCCCCAGCGCCAGGG - Intronic
1070907202 10:80083647-80083669 AGGAGCCTGCAGTGGGGAGAAGG + Intronic
1071437491 10:85660752-85660774 TGGACCCTGCCCAGGGAACATGG + Intronic
1076000132 10:126906749-126906771 AGGAGAGCGCTCCGGGGACAAGG - Intronic
1076721718 10:132396149-132396171 AGAAGCCCGGCCCGGGGCCAAGG + Intergenic
1076794966 10:132794011-132794033 AGGAGCCTGCTCCGGCGCCTTGG + Intergenic
1077141746 11:1027851-1027873 GGCACCCTGCCCTGGGGACATGG + Intronic
1080551377 11:33376319-33376341 AGGAGCCGGCCCGGGGGAGGGGG + Intergenic
1080857885 11:36128262-36128284 AGGGGTCTGGCCCAGGGACAGGG + Intronic
1081744204 11:45461728-45461750 ATGAGCTTGCCCAGGGAACATGG + Intergenic
1083421092 11:62553693-62553715 TGGAGCCAGCCCTGGGGCCAGGG - Intronic
1085254486 11:75164698-75164720 GGGACTCTGCCCTGGGGACAGGG - Intronic
1085306264 11:75487712-75487734 AGGAGCCTGCCCAGGGGCCTTGG + Intronic
1088986517 11:114914053-114914075 AGAAGCCTGCCCCAGGAACAAGG - Intergenic
1091222546 11:133937746-133937768 AGGAGGCTGCCCTGGGGAAACGG + Intronic
1091260837 11:134232911-134232933 CGCGGCCAGCCCCGGGGACAGGG - Intronic
1091265742 11:134269886-134269908 AGGGGACTGCCGCGTGGACAGGG + Intergenic
1091611215 12:2011341-2011363 AGGAGCCTTGTCCTGGGACATGG + Intronic
1091741645 12:2963850-2963872 AGGAGCCAGCCCCCGCTACAGGG - Intronic
1091899493 12:4133645-4133667 AGGAGTATGCCCAGAGGACAGGG + Intergenic
1095752316 12:45727254-45727276 AGGTGACTGCTCCGGGGACTTGG - Intergenic
1095954739 12:47799576-47799598 AGGAACCTGCCCTGGGCACAGGG - Intronic
1100980901 12:100161490-100161512 AGGTGTCTGCCCAGGTGACAGGG + Intergenic
1101466975 12:104958522-104958544 GGGAGCCTGCCCAGGAGAGAAGG + Intronic
1101923006 12:108948053-108948075 TGCAGCCTGCCCTGGGGAGATGG - Intronic
1102701570 12:114843837-114843859 ACAAGCCTGCCCAGGGGAAAAGG - Intergenic
1104852422 12:131883592-131883614 AGGAGCCTGCTCCAGGGCCAAGG - Intergenic
1104962192 12:132493593-132493615 AGAGACCTGCCCCGGGCACAGGG - Intronic
1105812602 13:24008380-24008402 ATCAGCCAGCCCCAGGGACAGGG - Intronic
1113438962 13:110313576-110313598 GGGAGCCTGCCGGGTGGACACGG - Intronic
1113438975 13:110313610-110313632 GGGAGCCTGCCGGGTGGACACGG - Intronic
1113439002 13:110313678-110313700 GGGAGCCTGCCGGGTGGACACGG - Intronic
1113439028 13:110313746-110313768 GGGAGCCTGCCGGGTGGACACGG - Intronic
1113439055 13:110313814-110313836 GGGAGCCTGCCGGGTGGACACGG - Intronic
1113439069 13:110313848-110313870 AGGAGCCTGCCGGGTGGACGCGG - Intronic
1114039106 14:18659900-18659922 AGGAGCCTGCAGTGGGGAGAAGG + Intergenic
1114571207 14:23670191-23670213 AGGAGGCTGCCATGGGGAGATGG - Intergenic
1118772561 14:68951975-68951997 AAGGGCCGGCCCTGGGGACAGGG - Intronic
1122913567 14:104845413-104845435 AGGAGCCAGCTCCAGGGACATGG - Intergenic
1123827810 15:24101270-24101292 AGGAGCCTCCCCAGGGGACAGGG - Intergenic
1123842266 15:24260681-24260703 AGGAGCCTCCCCAGGGGACAGGG - Intergenic
1123857293 15:24426743-24426765 AGGAGCCTCCCCAGGGGACAGGG - Intergenic
1123861921 15:24477271-24477293 AGGAGCCTCCCCGGGGGACAGGG - Intergenic
1124240395 15:28023535-28023557 CGCAGCCTGCCCTGGTGACAGGG - Intronic
1125180956 15:36880536-36880558 GGGAGCCTGGCCTGGGAACAGGG + Intergenic
1126096313 15:45093369-45093391 AGGGGCCTGCCCAGGGGTCAGGG + Exonic
1127165746 15:56243711-56243733 AGTAGAAAGCCCCGGGGACAAGG - Intergenic
1128783533 15:70378592-70378614 AGGGGCCTGCCCAGAGGAGATGG - Intergenic
1129328871 15:74816593-74816615 AGCAGCCTGAGCCGCGGACATGG - Intronic
1130322259 15:82850962-82850984 CTGAGTCTGCCCCGGGGGCAGGG + Intronic
1132405674 15:101540815-101540837 TGGAGCCAGCCCCGGGGATCTGG + Intergenic
1132609721 16:809383-809405 AGGAGCCTGCCTGGGGGTCGGGG - Intronic
1132702514 16:1228172-1228194 AGAAGCCAGCCTCGGGGACCAGG + Intronic
1132705810 16:1242696-1242718 AGAAGCCAGCCTCGGGGACCAGG - Intergenic
1132726006 16:1338659-1338681 AGGAGCCTGCCACGGGGGCCTGG + Exonic
1132766577 16:1537404-1537426 AGGAGCCTGCCTGAGGGACAGGG + Intronic
1135607369 16:23836126-23836148 AGGTGCCGGCCCCGGGGCCGCGG - Exonic
1136091474 16:27923290-27923312 AGGAGCCTTCTCGGGGTACAGGG - Intronic
1136096703 16:27962140-27962162 GAGAGCCTGCCACAGGGACACGG - Intronic
1136172748 16:28498327-28498349 AGGAGAAGGCCCCTGGGACACGG + Exonic
1136907902 16:34119174-34119196 AGGAGGCTGCTCAGGGGTCAAGG - Intergenic
1137620496 16:49873584-49873606 AGCAGCCTGCCCTGGTGACTGGG - Intergenic
1137840826 16:51639451-51639473 AGGATCCTGCCCCCGTGAAAGGG - Intergenic
1137954134 16:52811774-52811796 CAGAGCCTGGCCAGGGGACAAGG - Intergenic
1139652711 16:68370682-68370704 AGGGCCCTGGCTCGGGGACAGGG - Intronic
1141462622 16:84186789-84186811 GTGAGCCTGCCGCGGGGACTGGG + Intronic
1142109842 16:88325454-88325476 AGTACCCTGCCCAGGGGACCCGG + Intergenic
1142291440 16:89195244-89195266 AGGAGGCTGCCCCAGGCCCAGGG - Exonic
1142644280 17:1301939-1301961 AGAAGCGTGCCTCGGTGACAGGG + Intergenic
1143478232 17:7215032-7215054 AGGAGCCTGCAGGGGGCACATGG - Intronic
1144142807 17:12365945-12365967 CAGAGCCTGCCAAGGGGACAAGG - Intergenic
1146086725 17:29837553-29837575 AGTTGGCTGCCTCGGGGACATGG - Intronic
1146926127 17:36746889-36746911 AGGAGTCTGTACCGGGGAGAGGG - Intergenic
1147909415 17:43846491-43846513 AGAAGCTTGCCCCTGGGGCAAGG - Intergenic
1148108741 17:45132749-45132771 GGGAGCCGGCACCGGGGACGAGG + Intronic
1148739252 17:49882921-49882943 AGGACCCTGCCCAGGGGATTTGG - Intergenic
1150249740 17:63699199-63699221 AGGAGCCTGGCCTGGGGTGAAGG - Intronic
1151329450 17:73398294-73398316 ATGAGACTGGCCCGGGGAGAAGG - Intronic
1151701435 17:75744584-75744606 GGGAGTCTGGCCTGGGGACATGG - Intronic
1151807773 17:76417197-76417219 AGAAGCCTGCCCCTGAGTCAGGG - Intronic
1152656795 17:81523604-81523626 AGGGGCTTGGCACGGGGACAAGG + Intronic
1152739076 17:82011258-82011280 AGGGGCCTCCCCCAGGGAAAGGG + Intronic
1152893304 17:82895314-82895336 AGGACCCTGCCTCGGGTGCAGGG - Intronic
1154165127 18:12008986-12009008 TGGAGCCTGCACAGGGCACATGG + Intronic
1154289618 18:13095855-13095877 AGGAGTGTGGCCCTGGGACAAGG - Intronic
1156077756 18:33301319-33301341 AGAAGCCTGACCCAGGGGCAGGG + Intronic
1157622360 18:49023919-49023941 TGTGGTCTGCCCCGGGGACATGG - Intergenic
1157776747 18:50402107-50402129 AGAAGTCTGGCCCGGGGCCAAGG - Intergenic
1158847471 18:61459756-61459778 AGGAGCCTTCCCTGGGAAGATGG + Intronic
1159819682 18:73124414-73124436 AGGAGCCTTCTCCTGGTACATGG + Intergenic
1160163017 18:76490238-76490260 AGGAGCCTGCCGTGGTGTCAGGG - Intronic
1160581246 18:79885694-79885716 AGTGACCTGCCCAGGGGACATGG + Intronic
1161153378 19:2720903-2720925 AGGAGCCCACCCCGGGGAGGGGG + Intronic
1161595233 19:5147939-5147961 AGCTGCCTGCCCCGAGGCCAAGG + Intronic
1161994416 19:7703682-7703704 AGGAGGCAGTCCCAGGGACAAGG - Intergenic
1162109710 19:8393458-8393480 AGGCCCCTTCCCTGGGGACAGGG - Intronic
1163597065 19:18226370-18226392 GGGAGCCGGGCCCGGGGACCGGG + Intronic
1165782603 19:38442805-38442827 AGGAGCAGGCGTCGGGGACAGGG - Intronic
1166214147 19:41324994-41325016 TGGAGCCAGTCCCAGGGACAGGG + Intronic
1166999315 19:46736646-46736668 CGGAGCCTGGCCTGGGGAGAGGG - Intronic
1167255015 19:48422103-48422125 AGGAGCCTGCTCCTGGGAGGAGG - Intronic
1167516971 19:49929184-49929206 ATGAGGCGGCCCCGGGGACTGGG - Exonic
1167591240 19:50405704-50405726 AGAAGCCTGAGCTGGGGACAGGG - Intronic
925140933 2:1549467-1549489 AGGTGCTGGCCCCGGGGACTGGG - Intergenic
927883969 2:26707219-26707241 AGGAGCCTCCCACCCGGACAGGG + Intronic
927981320 2:27376874-27376896 TGCAGCCAGCCCAGGGGACAAGG - Exonic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
935556055 2:104510615-104510637 CGGGGCCTGCCCGGGGGTCAGGG + Intergenic
935830171 2:106994091-106994113 AGGAGGCTTCCCAGGGTACAGGG + Intergenic
936087909 2:109481834-109481856 AGGTGCCTGCCCAGGTCACAAGG + Intronic
936346128 2:111676777-111676799 AGGAGGCTGCCTCTGGGGCAGGG + Intergenic
936881663 2:117259513-117259535 AGGAACCTGCCCAGGGGAATTGG - Intergenic
937266895 2:120622406-120622428 AGGAGCGTGGCTCGGGGACCAGG - Intergenic
938063445 2:128269041-128269063 AGGAGCATGCCACGGTCACATGG + Intronic
938271501 2:129976047-129976069 AGGAGCCTGCAGTGGGGAGAAGG - Intergenic
943051259 2:182916037-182916059 AGGAAACTGCCCCGAAGACATGG - Intronic
943820599 2:192315430-192315452 AGTTGGCTGCCTCGGGGACACGG + Intergenic
947589886 2:231379547-231379569 AGGAGGCTGCCGCAGAGACAGGG + Intergenic
947621629 2:231594512-231594534 AGGAGCCTTCCCAGGGGCCTAGG + Intergenic
948270531 2:236670091-236670113 AGCAGCCAGCCTTGGGGACAAGG - Intergenic
948518956 2:238523677-238523699 GGGAGCCTGCCGCGGGACCAGGG - Intergenic
948613135 2:239182069-239182091 AGGACTCTGCCCTGGGGACCCGG + Intronic
948794780 2:240396841-240396863 CGGAGCCTGCTCAGGTGACATGG + Intergenic
949009411 2:241670040-241670062 AGCACTCTCCCCCGGGGACAGGG - Intronic
1170655467 20:18283408-18283430 AGGAGTCTGCCCCTGAGAAATGG - Intergenic
1171209158 20:23303632-23303654 TGTAGCCTGACCCTGGGACAAGG - Intergenic
1171424428 20:25040768-25040790 AGGAGGCTGCCCCTGGGGCTGGG - Intronic
1172095588 20:32458533-32458555 AGGAGCCTCCACGGGGGACAGGG + Intronic
1172760392 20:37317301-37317323 AGGGCCCTGCCCCGGGGATGAGG + Intergenic
1172857926 20:38022224-38022246 AGGAGCGAGCCCTGAGGACATGG - Intronic
1173151694 20:40571739-40571761 AAGAGCCTGGCCCAGGGAGAAGG + Intergenic
1173335673 20:42110574-42110596 AGGAACCTCCCGCAGGGACAGGG + Intronic
1174195023 20:48766850-48766872 AGGAACCTGCCCCAGAGAAAGGG - Intronic
1174610106 20:51791547-51791569 GGGTGCCAGCCCTGGGGACAGGG + Exonic
1175894971 20:62332112-62332134 AGGTGGCTGCCCTGGGGCCAGGG + Intronic
1175980039 20:62734124-62734146 AGGAGGCTGCGCAGGGGACAAGG - Intronic
1176111159 20:63411395-63411417 AGGGGCCTGTCCAGGGGGCACGG + Intronic
1176294796 21:5065727-5065749 AGGTGCCTGCCCCCGTGTCACGG + Intergenic
1179862253 21:44196399-44196421 AGGTGCCTGCCCCCGTGTCACGG - Intergenic
1179928682 21:44552306-44552328 CGGTCCCTGCCCCGGGGTCAGGG - Intronic
1180014886 21:45075208-45075230 CAGAGGCTGCCCCGGGTACAAGG + Intronic
1180203643 21:46243558-46243580 AGGGGCCTGCCCCATGGACTGGG + Exonic
1181314172 22:21961181-21961203 AGGAGCCTGCCGAGGGCCCATGG + Intronic
1181806363 22:25376823-25376845 GGGAGCCTGTCACGGGGAGAGGG - Intronic
1184263617 22:43333967-43333989 CAGAGCATGCCCCGAGGACATGG - Intronic
1184322657 22:43754364-43754386 AGGAGACTGACCCCGGGACCCGG - Intronic
1184520326 22:44990064-44990086 AGGCCTCTGCCCAGGGGACACGG - Intronic
1184824244 22:46936333-46936355 AGGAGCCTGGCCCCAGGACGAGG - Intronic
1185030512 22:48440616-48440638 AGGAGCCAAACCCAGGGACAGGG - Intergenic
1185073377 22:48669367-48669389 AGGGGGCTACCCCGGGGCCAAGG - Intronic
950169544 3:10828600-10828622 AAGAGACTGACCCTGGGACAAGG - Intronic
950192596 3:10988070-10988092 ATGAGCCTGCCCCCAGGAGATGG - Intergenic
950262638 3:11553859-11553881 ACGAGGCTGGCCCGGGGAGATGG - Intronic
950406468 3:12808193-12808215 CGGAGCCTGCACAGGGCACAAGG - Exonic
951846520 3:27090359-27090381 AGGAGCTTGCCCAGGGTACTTGG - Intergenic
954363751 3:50135661-50135683 AGGAGGCTGCCCCAAGAACAAGG - Intergenic
955826022 3:62948795-62948817 AAGAGCCTGGCCCTGGGGCAAGG - Intergenic
959580806 3:107980530-107980552 AGGAGCCTGGACAGGGGACCCGG - Intergenic
961036962 3:123649128-123649150 AAGAGCCTGACCCGAAGACAGGG + Intronic
961437272 3:126928010-126928032 AGGACACTGCCCTGGGGGCAGGG + Intronic
961513883 3:127420950-127420972 CTGTGCCTGCCCCGGGGAAAGGG - Intergenic
961822946 3:129584552-129584574 AGGATCATGCCCTGGGGGCAAGG + Exonic
962823275 3:139073879-139073901 AGGAGTCTGCAGCGAGGACATGG - Intronic
963537279 3:146544390-146544412 CGGAGCCTGCGCTGGGGCCAGGG - Intronic
967028646 3:185586025-185586047 CGGAGCCGGCCCGTGGGACAAGG - Intronic
968222346 3:196948267-196948289 AGGAGCCGGCGCCGGGTCCACGG - Exonic
968272659 3:197416465-197416487 ATCAGCCTGTCCCTGGGACAGGG - Intergenic
968480363 4:830466-830488 AGGGGCCTTCCCGGAGGACAGGG + Intergenic
969155574 4:5206783-5206805 AGGAGCCTGCCCCGGGGTCTGGG + Intronic
969184263 4:5463805-5463827 AGGAGACTGCCTTGTGGACAAGG - Intronic
969466078 4:7357198-7357220 TGATGCCTGCCCCGGGGACTCGG + Intronic
969677160 4:8620484-8620506 AGGAGCCCGCCCTGGGGACATGG - Intergenic
969678113 4:8626123-8626145 AGGAGCCCGCCCTGGGGACATGG - Intergenic
969679068 4:8631760-8631782 AGGAGCCCGCCCTGGGGACATGG - Intergenic
969723778 4:8907490-8907512 AGGAACCCTCCCCGCGGACAGGG + Intergenic
972872828 4:43321362-43321384 AGGAGACTACTCAGGGGACATGG + Intergenic
973246580 4:48016709-48016731 CGGAGGCTGCCCCGGGGGCGGGG + Intronic
976553299 4:86421607-86421629 AGGAGGCTGCTCCAGGCACAGGG + Intronic
979178290 4:117692345-117692367 AGGAGGCTGCTCTGGGGACATGG - Intergenic
981550293 4:145936640-145936662 CGGTGCCTGCCCAGGGGACCGGG - Intronic
982354325 4:154450092-154450114 AGGAGCCGACCCCTGGGAGAAGG + Intronic
983494514 4:168428024-168428046 AGGAGCCAGCCTTGGGCACAGGG + Intronic
986148962 5:5109623-5109645 AGGAGTTTCCCCTGGGGACAAGG + Intergenic
986737028 5:10675476-10675498 GGGACCCAGCCCAGGGGACAGGG - Intergenic
988093437 5:26570094-26570116 AGTCGCCTGCCTCAGGGACACGG + Intergenic
990539424 5:56757376-56757398 AGAAACCTTCCCAGGGGACATGG + Intergenic
991626248 5:68604014-68604036 AGCAGCCTGTCCCTGGCACAGGG + Intergenic
994182771 5:96785469-96785491 GGGACCATGCCGCGGGGACAAGG + Intronic
994242255 5:97437751-97437773 CGGAGGCTGCCCCAGGGCCAAGG - Intergenic
994353925 5:98774227-98774249 GGGAGCCAGCCCCGGGGCCTAGG + Intronic
995311683 5:110720142-110720164 TGGAGACTGCCCAGGGGAAAAGG - Intronic
999258044 5:150220703-150220725 AAGAGCCTGCCCCTGGGCCTGGG + Intronic
999260012 5:150232547-150232569 AGGGGCCTGCCTCTGGGAGACGG - Intronic
1001702907 5:173720643-173720665 AGGATCCTCCCCTGGGGACCTGG + Intergenic
1002131729 5:177086553-177086575 AGGAGCCTGGCCTGGGGCCTGGG + Intergenic
1002139217 5:177128643-177128665 TGGAGTCTGCCCAGGGGAAAAGG + Intergenic
1002194395 5:177494475-177494497 AGGAGCCAGCCCTGTGGGCAGGG - Intronic
1004252681 6:14034905-14034927 AGGAGCCTGGCTTGGGGAAATGG + Intergenic
1005826260 6:29633099-29633121 AGGAGGCGGCGCCGGGGACCAGG + Exonic
1007120112 6:39372743-39372765 AGGAGCCTGCCCAGGAGAAAGGG - Intronic
1007978494 6:46126131-46126153 AGGAGTCTGCCCCGTGGATGAGG + Intergenic
1010498616 6:76567017-76567039 AGAAGCCTGCCACAGGAACAGGG - Intergenic
1011525644 6:88261632-88261654 TTGAGCATGCCCTGGGGACATGG + Intergenic
1012908091 6:105090662-105090684 AGCATCCTGCCCCGGCAACATGG + Intergenic
1013467332 6:110429330-110429352 GAGCGCCTGCTCCGGGGACATGG + Intronic
1013591067 6:111620088-111620110 AGGAGCCTGCCCAGGCGCCGTGG - Intergenic
1015966399 6:138698785-138698807 ATGAGGCTGCCCCAGGGAAAGGG - Intergenic
1018149706 6:160926463-160926485 ACTGGCCGGCCCCGGGGACAAGG - Intergenic
1018180476 6:161218598-161218620 AGGATCCTGCCCCGGTGTTATGG - Intronic
1018456732 6:163960288-163960310 AGGAGCATGTCCCGGGGCCAAGG - Intergenic
1019324600 7:432010-432032 ACAAGCCTGGGCCGGGGACAGGG + Intergenic
1019492494 7:1321864-1321886 AGGAGCCTCCCACGGGGGCGGGG + Intergenic
1019644920 7:2124015-2124037 AGGAGCCTGACCTGGCTACAGGG - Intronic
1019816716 7:3206294-3206316 AGAAACCTGCCCTGGGCACAAGG - Intergenic
1020014193 7:4821340-4821362 AGGAGCCGGCCCAGGGAACTGGG - Intronic
1020276576 7:6628292-6628314 GGCAGCCTGCCCCAGGGACATGG + Intergenic
1020774902 7:12441151-12441173 AAGAGCCTTACCCAGGGACATGG - Intergenic
1022475229 7:30705716-30705738 AGGAGCCTGCACATGGGACAGGG - Intronic
1025249261 7:57341123-57341145 AAGAGGCTGCCCAGGGCACAAGG + Intergenic
1026522937 7:71132241-71132263 AGGCGCCTGCCCGGGGGAGCGGG + Exonic
1026795156 7:73361614-73361636 AGGAGGCTGGGCTGGGGACAGGG - Intergenic
1027248001 7:76380129-76380151 AGGAGGCTGCCGTGGGGCCAGGG + Intergenic
1029639845 7:101814190-101814212 AGAAGCCTGACTCCGGGACAGGG + Intergenic
1032195520 7:129786218-129786240 CGGAGCCTGCCCAGGGGACCAGG - Intergenic
1032753535 7:134866136-134866158 AGGAGCCTACCCCAGGGAGAAGG + Intronic
1033537744 7:142327839-142327861 ATGAGCCTGCCCCTGGGATTTGG + Intergenic
1033543629 7:142380322-142380344 ATGAGCCTGCCCCTGGGATTTGG + Intergenic
1033551272 7:142450501-142450523 ACGAGCCTGCCCCTGGGATTTGG + Intergenic
1033882510 7:145902721-145902743 AGGAGCTTGGGCCTGGGACAGGG + Intergenic
1034232985 7:149547243-149547265 AGGAACCTGCCCAGGGCAGATGG + Intergenic
1034449088 7:151127907-151127929 AGGAGCCTGCCCCGGGGACAGGG - Intronic
1034691401 7:153017319-153017341 ACGAGGCTGCCCCGGGGATCTGG - Intergenic
1035737356 8:1898361-1898383 AGGAGGCGGCCCCAGGGGCAGGG + Intronic
1036454058 8:8892926-8892948 CGGGGCCTGCCCCGGGGCCGGGG - Exonic
1037420434 8:18696067-18696089 AGGTGCCTGGCCCAGGGTCATGG + Intronic
1037510337 8:19576088-19576110 AGGAGCCTGCACAGAGAACAGGG - Intronic
1040106455 8:43544947-43544969 AGAAGCCTCCCCGGGTGACAGGG - Intergenic
1048517980 8:135127699-135127721 AGGATCCAGCCCCTGGGATAAGG - Intergenic
1048980519 8:139701556-139701578 AGGTCCCTGCCCAGGGCACAGGG + Intronic
1049421981 8:142521047-142521069 AGGAGGCTGCCCCAGCTACAGGG + Intronic
1049563956 8:143327785-143327807 CGGAGCCTGCACAGGGGACAAGG + Intronic
1049638945 8:143705643-143705665 AGGAGCCGGCCCGCGGGACAAGG + Intronic
1049781120 8:144429386-144429408 TGGAGCCTGCCGCGGGCACCAGG - Intronic
1053366171 9:37524058-37524080 AGGGGCCTGCAGTGGGGACATGG - Intronic
1056572046 9:87824964-87824986 AGGGGCCTGCGGCGGGAACAGGG - Intergenic
1060404873 9:123368236-123368258 AGGAGCCTGCCAGGGGGAGGAGG - Intronic
1060477398 9:123996922-123996944 AGGAGCCTGCCAAGGGGCCCCGG - Intergenic
1061168401 9:128937887-128937909 AGGAGCCTGGCCCGGAGAGGAGG + Intronic
1061657445 9:132103773-132103795 AGGTGGCTGCCTCTGGGACAAGG + Intergenic
1062126329 9:134864934-134864956 AGGATTCGGCCCCGGGGAGACGG - Intergenic
1062244995 9:135561637-135561659 AGGAAGCTGCCCAGGGGCCAAGG + Intergenic
1062508969 9:136894450-136894472 AGAAGCCTGCGCCCAGGACAAGG - Intronic
1062638259 9:137502749-137502771 GGGAGCCGGCCACGGTGACATGG + Intronic
1062654067 9:137593061-137593083 AGGTGCCTGCCCCTGGGAGAGGG - Intergenic
1185871381 X:3667724-3667746 AGGAGACTGCCATGGGGACTGGG - Intronic
1186501573 X:10055119-10055141 AGGATCCTGCCCAGGGAAGATGG + Intronic
1187420930 X:19133096-19133118 CCCAGCCTGCCCCGGGGACGTGG - Intergenic
1189269037 X:39737389-39737411 AGGAGCCTGCCAGGCAGACAAGG - Intergenic
1189285910 X:39852329-39852351 AGGAGCCTGCCCAGGGGTCAGGG + Intergenic
1190574864 X:51825153-51825175 AGGAGCCTGTCCAGAGGCCATGG + Intronic
1190886128 X:54532003-54532025 AGGAGTCTACCCTGGGGAAAAGG - Intronic
1192172767 X:68867262-68867284 ATGAGCCTGGCCCTGGGACTGGG - Intergenic
1194559587 X:95403923-95403945 AGGTGCCTGTCCCAGGGAGATGG - Intergenic
1200009238 X:153108862-153108884 AAGAGCCTCCCCCAGGGGCAGGG - Intergenic
1200030362 X:153291060-153291082 AAGAGCCTCCCCCAGGGGCAGGG + Intergenic
1200175743 X:154115088-154115110 AGGAGCGTGCCCCAAGAACAGGG + Intergenic
1200792725 Y:7313972-7313994 AGGAGACTGCCGTGGGGACTGGG + Intergenic
1201283429 Y:12360079-12360101 AGAAGCCTGGCCCAGGGCCAAGG + Intergenic
1201290983 Y:12420919-12420941 GGGCGCCTGGCCTGGGGACACGG - Intergenic