ID: 1034450031

View in Genome Browser
Species Human (GRCh38)
Location 7:151132351-151132373
Sequence ACTTTAGCACATGTGTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034450028_1034450031 18 Left 1034450028 7:151132310-151132332 CCTCGGTTATGTCGTTCTGTGGT 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1034450031 7:151132351-151132373 ACTTTAGCACATGTGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034450031 Original CRISPR ACTTTAGCACATGTGTGCTC AGG Intronic
No off target data available for this crispr