ID: 1034450605

View in Genome Browser
Species Human (GRCh38)
Location 7:151135252-151135274
Sequence CACTGGGGATACTGAAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034450605_1034450612 10 Left 1034450605 7:151135252-151135274 CCAAGACTTCAGTATCCCCAGTG 0: 1
1: 0
2: 2
3: 25
4: 177
Right 1034450612 7:151135285-151135307 CCATTGGATCTCATGTTCCCTGG No data
1034450605_1034450613 11 Left 1034450605 7:151135252-151135274 CCAAGACTTCAGTATCCCCAGTG 0: 1
1: 0
2: 2
3: 25
4: 177
Right 1034450613 7:151135286-151135308 CATTGGATCTCATGTTCCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 160
1034450605_1034450609 -6 Left 1034450605 7:151135252-151135274 CCAAGACTTCAGTATCCCCAGTG 0: 1
1: 0
2: 2
3: 25
4: 177
Right 1034450609 7:151135269-151135291 CCAGTGTTGTCCTAGACCATTGG 0: 1
1: 0
2: 0
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034450605 Original CRISPR CACTGGGGATACTGAAGTCT TGG (reversed) Intronic
903209960 1:21812373-21812395 CTCTGGGGAGACTGGAGTATGGG - Exonic
903515705 1:23909441-23909463 AAATGAGGACACTGAAGTCTCGG - Intronic
903650395 1:24918280-24918302 CTCTGGGAAGACTGAAGCCTGGG + Intronic
906655296 1:47543819-47543841 GAATGGGCATCCTGAAGTCTGGG + Intergenic
908039215 1:60089480-60089502 CAATGGGGAAACTGAGGTCTAGG + Intergenic
908565734 1:65354346-65354368 CACTGAGGAAACTGAGGTTTTGG - Intronic
911374221 1:97030933-97030955 AACAGGGGATACTAAAGGCTGGG + Intergenic
915607655 1:156963263-156963285 ATCTGGAGAAACTGAAGTCTCGG - Exonic
916476246 1:165171881-165171903 CAATGAGGAAACTGAAGCCTGGG - Intergenic
917898606 1:179517708-179517730 CACTGGGGAAACTGAAGGTCTGG - Intronic
921554442 1:216581014-216581036 CACTATGGAAACTGAAGTATGGG + Intronic
922822457 1:228493708-228493730 CCCTGGGGAGACGGAAGTCTGGG + Intronic
923289405 1:232529971-232529993 GACTGCTCATACTGAAGTCTGGG - Intronic
1067205548 10:44209075-44209097 CACTGGGGAGACTGGGGTCCTGG - Intergenic
1067787761 10:49263017-49263039 CACTGGGGACACTGACCTCTTGG - Intergenic
1070505709 10:77111113-77111135 AAGTGGGGAAACTGCAGTCTCGG - Intronic
1070645948 10:78202710-78202732 CACTGGGAAACCTGAACTCTTGG + Intergenic
1071108419 10:82125865-82125887 CACAGAGCATACTGAAGTCCAGG - Intronic
1077151189 11:1073852-1073874 CAGTGGGTAAACTGAGGTCTGGG - Intergenic
1077366850 11:2164729-2164751 CACTGGGGAAACTGAGGCCAGGG - Intronic
1079422423 11:20306281-20306303 TAGTGGGGAAACTGAAGTATAGG + Intergenic
1079634801 11:22723245-22723267 CACTGGGGATTCTCAAGTTTTGG + Intronic
1079976314 11:27095849-27095871 CAAAAGTGATACTGAAGTCTGGG + Intronic
1080098601 11:28433467-28433489 CACATGAGAAACTGAAGTCTAGG - Intergenic
1081805585 11:45888232-45888254 CAATGGGGATACCAAAGTTTGGG - Intronic
1082707683 11:56512656-56512678 CACTGGGGCCACAGAAGGCTAGG + Intergenic
1083999289 11:66287595-66287617 CACTGGGGATATAGAGGTCAGGG + Exonic
1084210024 11:67616568-67616590 CACTGGGGACACAGCAGTCACGG - Intergenic
1085171620 11:74454428-74454450 CACTGGGGACACTGAAGTCATGG + Intergenic
1087906189 11:103700336-103700358 CACTGGGGCTACCCAAGGCTTGG - Intergenic
1091531159 12:1356991-1357013 CATTGGGGCTACTGAGATCTTGG - Intronic
1092709903 12:11324964-11324986 CACTGGGGAAGCTGCAGTCCTGG + Intergenic
1092717372 12:11404643-11404665 CACTGGGGAAGCTGCAGTCTTGG + Intronic
1101469648 12:104984515-104984537 CACTGGTGATACAGAATTATTGG - Intergenic
1104648130 12:130511548-130511570 CACTGGGGTGACTGAAGCCCTGG - Intronic
1106525453 13:30536857-30536879 CACTTGGGCTACTGACTTCTTGG + Intronic
1107297674 13:38929460-38929482 CACCTGGGATACTGAGCTCTAGG - Intergenic
1107666340 13:42694401-42694423 CACTGGAGAAGCTGAAGTTTGGG - Intergenic
1108576976 13:51799232-51799254 CACTGGGGATTCTGATGTCCAGG + Intronic
1109508506 13:63337433-63337455 CAATGGGGAAACTGAAGGCCTGG - Intergenic
1114800571 14:25771228-25771250 GAATGGGAATACTGAAGTGTTGG + Intergenic
1114978029 14:28126196-28126218 CACTGGGGATATAGAAGTTGAGG - Intergenic
1119584562 14:75821061-75821083 CAGAGGGGGTACTGAAGACTTGG + Intronic
1121621115 14:95348929-95348951 CGCTGGGGATGCTGAAGGCTTGG - Intergenic
1121710038 14:96030900-96030922 CCCTGGGGATACGGAGGTGTCGG - Intergenic
1202932863 14_KI270725v1_random:54831-54853 TCCTGGGGATACAGAGGTCTCGG - Intergenic
1125492640 15:40159678-40159700 CACTGGGGATAGTGGATTCAGGG - Intergenic
1129688474 15:77699814-77699836 CACTGGGGATGCTGAGGACTGGG - Intronic
1130013437 15:80170047-80170069 CAGAGGGGACACTGAAATCTGGG + Intronic
1133027552 16:2995331-2995353 CACTGGGGAGACAGAAGCCCGGG - Intergenic
1134633452 16:15774205-15774227 AACTCGGGATAATGAAGTCTTGG - Intronic
1135435115 16:22421392-22421414 CACTGGGGATCCTGCAGTCAGGG + Intronic
1136523664 16:30814258-30814280 CACTGTGGACCCGGAAGTCTGGG - Intergenic
1139480850 16:67229901-67229923 CACTGGGTAAACTGGAGCCTGGG + Exonic
1140102949 16:71934169-71934191 CGCTGGGGAAACTGCAGTATAGG - Intronic
1140197302 16:72865768-72865790 CTCTGTGGATACAGAAGCCTTGG - Intronic
1140737522 16:77911533-77911555 GTCAGGGGATGCTGAAGTCTTGG - Intronic
1142044307 16:87915167-87915189 CACTGGGGATCCAGAGGTCAGGG + Intronic
1143067007 17:4257726-4257748 CACAGGGAGTTCTGAAGTCTAGG - Intronic
1145242430 17:21247813-21247835 CACTGTGGATCCTGCTGTCTCGG - Intronic
1145242617 17:21248633-21248655 CACTGTGGATCCTGCTGTCTCGG + Intronic
1147792219 17:43021099-43021121 CACTGGGGTTTCTGAAGTGGGGG + Intronic
1147839446 17:43360741-43360763 CACTTGGGATAGTGAAGTATGGG + Intergenic
1148898209 17:50853157-50853179 CACTTCACATACTGAAGTCTTGG - Intergenic
1149149633 17:53545014-53545036 CAAAGGGAATCCTGAAGTCTTGG - Intergenic
1149283458 17:55133458-55133480 GACTGGGGATAGAGAATTCTGGG + Intronic
1157195372 18:45616575-45616597 AACTGGGGAGACTGAAGTGAGGG + Intronic
1157563970 18:48667461-48667483 CAGTGGGGACACTGAGGCCTGGG + Intronic
1158477078 18:57789946-57789968 CATTGGTGATTCAGAAGTCTAGG - Intronic
1158807369 18:60990583-60990605 CACTGGTGATTCTGAAGGGTGGG - Intergenic
1162188884 19:8929087-8929109 CAGAGGGGACACTAAAGTCTGGG + Intronic
1163628323 19:18403605-18403627 CTCTGGGGATCCAGAGGTCTGGG + Intergenic
1163628345 19:18403669-18403691 GTCTGGGGATCCAGAAGTCTGGG + Intergenic
1166496469 19:43306458-43306480 CCCTGGGGACAGTGATGTCTGGG + Intergenic
1167066495 19:47190134-47190156 AACTCAGGATGCTGAAGTCTGGG - Intronic
1167108763 19:47446969-47446991 CACTGGGGAGCCTGAGGGCTGGG - Intronic
926617989 2:15018114-15018136 AACAGAGGATACTGAAGACTGGG + Intergenic
929541941 2:42829336-42829358 AACTGGGGATCCAGAAGGCTTGG + Intergenic
932087152 2:68772474-68772496 CACTGAGGCTACTGAAGTGGGGG + Intronic
935210815 2:100938348-100938370 CTCTGGGAAGACTGATGTCTTGG + Intronic
940935278 2:159487036-159487058 CAATGGGGAAACTGGATTCTAGG + Intronic
941055840 2:160786897-160786919 GACTGGGGAAAAGGAAGTCTGGG + Intergenic
941342226 2:164321312-164321334 CACTGGGGAAACTGGAGTGAGGG + Intergenic
942274624 2:174311240-174311262 CACTGGTGATACTGGATTTTAGG - Intergenic
1169052933 20:2595797-2595819 CACTGGGTAGAGTGAAGTCTGGG + Intronic
1170610629 20:17909944-17909966 GACTGGGGAGACAGAGGTCTTGG - Intergenic
1173072509 20:39782655-39782677 CTTTGGGGGTTCTGAAGTCTTGG - Intergenic
1173442221 20:43087867-43087889 CACAGAGGACACTGAAGGCTGGG + Intronic
1176594250 21:8676894-8676916 TCCTGGGGATACAGAGGTCTCGG - Intergenic
1177017200 21:15807031-15807053 TACTTGGGAGACTGAGGTCTGGG - Intronic
1178894707 21:36548874-36548896 CACTGGGGTCACTGCAGTCAGGG - Intronic
1179098830 21:38338576-38338598 CAGTGGGGACTCTGAAGCCTAGG + Intergenic
1180277103 22:10654028-10654050 TCCTGGGGATACAGAGGTCTCGG - Intergenic
1180954677 22:19736355-19736377 CACTGGGAGTACTGAGATCTGGG + Intergenic
1181260022 22:21591033-21591055 CCCTGGGGATTATGAAGCCTGGG - Intronic
1181372302 22:22428235-22428257 AACTGATGACACTGAAGTCTTGG + Intergenic
1182429380 22:30291025-30291047 AGCTGGGGATACTGAGGCCTAGG - Intronic
1182769881 22:32787002-32787024 CATTCGGGATGCTGAAGTATGGG - Intronic
1182801922 22:33038624-33038646 CACTGGGGATGGGGCAGTCTTGG - Intronic
1183076684 22:35431806-35431828 CACAGAGGGAACTGAAGTCTGGG - Intergenic
1183646051 22:39127328-39127350 CACTGAGGATGGTGGAGTCTGGG + Intronic
1183760227 22:39809782-39809804 CACTGGGAATACTGGGGTCCTGG + Intronic
1185407012 22:50658194-50658216 CACTGGGGATACAGCAGTCTTGG - Intergenic
952577248 3:34790226-34790248 AACTGGGGATGCTGAATTATTGG - Intergenic
952722996 3:36552972-36552994 GACTGAGGAAACTGAAGTGTTGG + Intergenic
953372156 3:42397923-42397945 GACTGGAGAACCTGAAGTCTGGG - Intronic
953837386 3:46358577-46358599 CACTGGGGAGCAGGAAGTCTCGG + Intronic
953936338 3:47046587-47046609 CCCTGGATATACTGAAGACTTGG + Exonic
955523407 3:59796750-59796772 CACTGAGAATACTGCAGTCTTGG - Intronic
956650793 3:71502724-71502746 CACTGGGGAAACTGAGGCTTAGG - Intronic
956721831 3:72124788-72124810 TACTTGGGAGGCTGAAGTCTGGG + Intergenic
956888697 3:73587735-73587757 CCCTGGGCATGCTGAAGTCAGGG + Intronic
957566997 3:81896730-81896752 CACTGGGGATACAGAGGACTCGG + Intergenic
958685066 3:97382545-97382567 TACTGGGTATACCGAAGTCAGGG - Intronic
960431952 3:117580286-117580308 CTCTAGGGATTCTAAAGTCTAGG + Intergenic
961033044 3:123623163-123623185 CTCAGGGGAAACTGTAGTCTTGG - Intronic
961201483 3:125049163-125049185 GACTGGGGAGAATGAGGTCTGGG - Intronic
961362134 3:126374768-126374790 CACTGAGGTGACTGAAATCTTGG + Intergenic
961529702 3:127533042-127533064 AGCTGGGGAGACTGAAGGCTGGG - Intergenic
961634110 3:128322116-128322138 CACTGGGGATTCTCAATTCATGG - Intronic
962178770 3:133183383-133183405 CACTGGGGAGTGAGAAGTCTTGG + Intronic
963548298 3:146688802-146688824 AACAGGAGATACTGGAGTCTGGG - Intergenic
964475387 3:157093070-157093092 CAATGGGGATATTGAATTATTGG + Intergenic
965614537 3:170580070-170580092 CATAGGGAATACTGAATTCTTGG + Intronic
965923781 3:173952268-173952290 CTCCGGAGAGACTGAAGTCTGGG - Intronic
967518517 3:190400195-190400217 GACAGAGGATACTGAAGGCTGGG - Intronic
968486412 4:865144-865166 CACTGCCGATGCTGCAGTCTCGG + Exonic
968959640 4:3736665-3736687 CACTGGCAACACTGGAGTCTGGG - Intergenic
975355267 4:73395302-73395324 CACTGGGGATACTGCTGTGATGG + Intergenic
975784929 4:77877623-77877645 CACTGGGCCTACTTAAGACTAGG - Intronic
977070386 4:92377379-92377401 CAATGGGGACAATAAAGTCTGGG - Intronic
977966427 4:103155046-103155068 CACCAGGGATCCTAAAGTCTGGG - Intronic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
979874528 4:125871485-125871507 TACTGGCAATGCTGAAGTCTAGG - Intergenic
981105675 4:140878003-140878025 CACTGTGGCTCCTGAAGTGTTGG + Intronic
985614935 5:914444-914466 CACTGGGGAGACAGAAGTACAGG - Exonic
986515046 5:8552588-8552610 CACTGGGGAAACTGCAATGTGGG + Intergenic
988908956 5:35820556-35820578 CACTGGGGAGATAGAAGTTTGGG - Intergenic
989452005 5:41597608-41597630 TACTGGGGAGGCTGAGGTCTTGG - Intergenic
990504765 5:56433422-56433444 CACTGGGGAGGCTGGAGTCTGGG - Intergenic
993996420 5:94728944-94728966 CTCTGAGGATACTGGACTCTGGG + Intronic
994568491 5:101483513-101483535 CACTGGGGAAACTGAAGTTCTGG - Intergenic
995722393 5:115150768-115150790 CACTGGGGAAACTGAAGACCTGG + Intronic
995909426 5:117167941-117167963 CCTTGGGGATAGTGAACTCTTGG + Intergenic
996748713 5:126868247-126868269 CATAGGGGATTCTGAACTCTTGG - Exonic
998298288 5:140993003-140993025 CACAGGGGATGCTGGACTCTGGG - Intronic
998453128 5:142249988-142250010 CAGTGGGGAAACTGAGGCCTGGG + Intergenic
999320244 5:150609996-150610018 AACTGGGGAGACTGAAGTCATGG - Intronic
1001217294 5:169867818-169867840 CACTGGGGAGAATGAAGTATAGG - Intronic
1002109473 5:176898695-176898717 CTCTGGGGATACTGCAGTGAAGG - Intronic
1003773605 6:9335603-9335625 CAGTGTGGAGACTGAAGGCTGGG - Intergenic
1006934033 6:37705222-37705244 CACTGGGGCTGCTGAGGCCTGGG - Intergenic
1008674318 6:53803328-53803350 CACTGTGCTCACTGAAGTCTAGG + Intronic
1010055363 6:71558148-71558170 CAGTGGGGATACTGGGCTCTGGG + Intergenic
1010418280 6:75641129-75641151 AACTGTGGATACTGTAGGCTGGG - Intronic
1011154084 6:84310186-84310208 CATTGAGGATACTGAGGTCATGG + Intergenic
1011833628 6:91403925-91403947 CACTGGGGAACCTGAAGGTTTGG + Intergenic
1013376060 6:109515381-109515403 CACTGGTGATGATGAAGACTGGG + Intronic
1013384743 6:109615180-109615202 GAGTAGGGATACTGAAGTGTTGG - Intronic
1014440457 6:121467995-121468017 TTCTGGGGATACTGAAATGTGGG + Intergenic
1014809584 6:125870592-125870614 TAGTGGTGATACTGAAGTCTTGG - Intronic
1015054386 6:128882707-128882729 CTCTGGGGACACTGCAGGCTGGG - Intergenic
1015325014 6:131915091-131915113 CTCAGGGGTCACTGAAGTCTGGG + Intergenic
1015610872 6:135016422-135016444 CAATGGGGAACCTGAAGGCTAGG + Intronic
1016220218 6:141659709-141659731 CACTGGAGATACTGAAGGTTTGG + Intergenic
1018217602 6:161545286-161545308 CACTGGAGTTAATGACGTCTAGG + Intronic
1018492552 6:164308821-164308843 TCCTGGGAATACAGAAGTCTAGG + Intergenic
1019078443 6:169410794-169410816 AACTGGGGAGACTGAATCCTGGG - Intergenic
1019625739 7:2014811-2014833 GTCTGGGGATGCTGAACTCTGGG - Intronic
1022534494 7:31087361-31087383 CACTGGTGATACTGACTTTTGGG + Intronic
1023704096 7:42921675-42921697 CACTTAATATACTGAAGTCTAGG + Intronic
1023874286 7:44278348-44278370 AGCTGGGGAAACTGAGGTCTAGG + Intronic
1027627495 7:80563980-80564002 CACAGGGGAAGCTGCAGTCTGGG + Intronic
1027808942 7:82867480-82867502 CACTGGAGATACTAAAGCATTGG + Intronic
1031289212 7:119910963-119910985 CACAGGGGATTTTGAAGTCTTGG - Intergenic
1031965558 7:128025766-128025788 CTCTGAGGATACTTAAATCTAGG + Intronic
1034450605 7:151135252-151135274 CACTGGGGATACTGAAGTCTTGG - Intronic
1037511010 8:19582776-19582798 CACAGGGGCTACTGATTTCTAGG - Intronic
1037582229 8:20252538-20252560 CACTTGGGAAACTGAAATCTAGG + Intronic
1039314240 8:36354171-36354193 CACTGGAGATTCAGAAGTGTGGG + Intergenic
1039861852 8:41466017-41466039 CATTGGGGATGATGAATTCTGGG - Intergenic
1040682304 8:49827213-49827235 CCCTGGGGATACTGAATAGTGGG - Intergenic
1044813675 8:96089281-96089303 CACTGTGAATAAGGAAGTCTTGG + Intergenic
1044884801 8:96765836-96765858 CACTGGAGATACTGAAGTAAGGG + Intronic
1046012509 8:108566442-108566464 CACTGGTTACAATGAAGTCTAGG - Intergenic
1046271634 8:111904521-111904543 CAGTGGGTAGCCTGAAGTCTGGG + Intergenic
1047709253 8:127534290-127534312 CACAGGTGATAATGAAATCTTGG - Intergenic
1048238880 8:132720863-132720885 CACTGAGGATACTGAAGTGAGGG + Intronic
1050304809 9:4297530-4297552 CTCGGGAGATGCTGAAGTCTTGG + Intronic
1055446248 9:76385370-76385392 CACAGGGGATCCTGAAGGCAAGG + Intergenic
1059365136 9:113781003-113781025 CACTGGGGATACGGAAGGGATGG + Intergenic
1060817202 9:126641229-126641251 CACAGGGGAGCCTGAAGTCCAGG + Intronic
1061445159 9:130633445-130633467 CTCTGGGGACACTGAGGCCTGGG + Intronic
1061838031 9:133342065-133342087 CACTGGGGTTTCTGCAGTCAGGG - Intronic
1203624382 Un_KI270749v1:157164-157186 TCCTGGGGATACAGAGGTCTCGG - Intergenic
1189016523 X:37290747-37290769 CATTGGTGATGCTGGAGTCTGGG - Intergenic
1189274872 X:39778359-39778381 CACTGGGCAGGCTGAAGGCTTGG + Intergenic
1192588631 X:72340960-72340982 CACTGTGGATCCTGAAGTGAAGG + Intronic
1193450383 X:81658206-81658228 CACTGGGGGGCCTGAAGTCAAGG - Intergenic
1195504053 X:105636629-105636651 CACTGGGGATACAGAAATAAAGG + Intronic
1196556143 X:117086816-117086838 CAGTGGGCACACTGCAGTCTAGG + Intergenic
1196791227 X:119467162-119467184 CTATGGGAATTCTGAAGTCTGGG + Intergenic
1202249063 Y:22851045-22851067 CACTGAGGATAGAAAAGTCTTGG + Intergenic
1202402051 Y:24484793-24484815 CACTGAGGATAGAAAAGTCTTGG + Intergenic
1202468731 Y:25185290-25185312 CACTGAGGATAGAAAAGTCTTGG - Intergenic