ID: 1034455145

View in Genome Browser
Species Human (GRCh38)
Location 7:151166227-151166249
Sequence CACCATTCATGGAGGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034455140_1034455145 -8 Left 1034455140 7:151166212-151166234 CCTCTATGGAGAGGGCACCATTC 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1034455145 7:151166227-151166249 CACCATTCATGGAGGGTCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 88
1034455138_1034455145 -3 Left 1034455138 7:151166207-151166229 CCCTGCCTCTATGGAGAGGGCAC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1034455145 7:151166227-151166249 CACCATTCATGGAGGGTCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 88
1034455139_1034455145 -4 Left 1034455139 7:151166208-151166230 CCTGCCTCTATGGAGAGGGCACC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1034455145 7:151166227-151166249 CACCATTCATGGAGGGTCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034455145 Original CRISPR CACCATTCATGGAGGGTCCA GGG Intronic
901222235 1:7589826-7589848 CAGCATTGATGGAGGGGCCTCGG - Intronic
902077113 1:13796095-13796117 CACCCTTCTTTGAGGGTTCAAGG + Intronic
903765036 1:25728652-25728674 AACCATTCATGGATATTCCAAGG - Intronic
907247523 1:53117610-53117632 CACCATCCCAGGAGGTTCCAGGG - Intronic
907410818 1:54282094-54282116 CACCATTCAGGGAGGTTGCAAGG + Intronic
909249049 1:73328047-73328069 CACCAGTCCAGGAGGGTACAAGG - Intergenic
911105969 1:94131755-94131777 CACCATTCATGGGGGATCCTAGG - Intergenic
911808223 1:102238761-102238783 CAGCATTCATGAAGGGCCCTTGG - Intergenic
912568006 1:110602521-110602543 CACCATTTTTGCAGGCTCCAGGG - Exonic
915287841 1:154864181-154864203 CACCCCACAGGGAGGGTCCATGG + Intronic
915730422 1:158049910-158049932 CCCAATTCACTGAGGGTCCATGG - Intronic
921740197 1:218675837-218675859 CAGAATGCATGGAGGGTCCTTGG - Intergenic
1067028638 10:42865877-42865899 CACCCTTCAGGGGGCGTCCATGG + Intergenic
1069638084 10:69937723-69937745 CACCAGTCTTGCTGGGTCCAAGG - Intronic
1069957262 10:72059802-72059824 GACCACTCAGAGAGGGTCCAAGG - Exonic
1071008505 10:80911030-80911052 CAGCCTCCCTGGAGGGTCCAAGG - Intergenic
1071496143 10:86168866-86168888 CACCATTCAGGGAGACTCCCTGG + Intronic
1072327537 10:94313340-94313362 CACTATTAATGGAGGCACCAAGG + Exonic
1073455882 10:103636530-103636552 CCCCATTCCTGGAGAGTCTAAGG - Intronic
1075560873 10:123467649-123467671 CTCCATACATGCAGGGACCAGGG - Intergenic
1076015935 10:127027767-127027789 CACCCCACATGGAGGGCCCAGGG - Intronic
1077517234 11:3009358-3009380 CTCCACTCATGTAGGGTCCCTGG + Intronic
1077796576 11:5498710-5498732 CACCATGCATGCTGGGTCCTTGG + Intronic
1078417326 11:11176514-11176536 CACCAGTCCTAGAGGGTCCCAGG + Intergenic
1082801233 11:57416404-57416426 CTCACTTAATGGAGGGTCCAGGG - Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089534812 11:119154453-119154475 CACCATTGGCGGAGGGTTCAAGG + Intronic
1100743853 12:97624055-97624077 ATCCATGCATGGAGTGTCCATGG + Intergenic
1105255897 13:18743962-18743984 CACCGGTCATGGAGGTGCCATGG + Intergenic
1110814533 13:79846636-79846658 CACCATTGATGCAGGTGCCATGG - Intergenic
1113412254 13:110100690-110100712 CAACATTCCTGGGTGGTCCAGGG - Intergenic
1113577238 13:111403268-111403290 CACCAGTCATGCAGGGGCCACGG - Intergenic
1113913507 13:113856072-113856094 CACCATTTATGGTGGAGCCATGG + Intronic
1128035234 15:64519096-64519118 AACCATTCTTGGCGGGTGCAGGG + Intronic
1133247881 16:4461445-4461467 CAGCAGTAAGGGAGGGTCCAAGG - Intergenic
1136169079 16:28477421-28477443 CACAGTTCATGGAGGGTCTCTGG + Exonic
1136226968 16:28866082-28866104 CACCATTCATGATGGGCCCCAGG - Exonic
1139524292 16:67504238-67504260 CACAGTTCAAGGAGGTTCCATGG + Intergenic
1139957095 16:70698282-70698304 CACCATGCAGGGTGGGCCCACGG + Intronic
1140955892 16:79864956-79864978 CACCTATCATGGATGGTCCCAGG - Intergenic
1142103049 16:88285722-88285744 CACCACTCAGAGAGGGCCCAGGG - Intergenic
1145772620 17:27504518-27504540 CACCCTTCAAGCAGGCTCCAGGG - Intronic
1147453832 17:40522251-40522273 CACCTTTCATAGAGGGTTAAGGG - Intergenic
1150468069 17:65412002-65412024 CATCATTCTTATAGGGTCCAGGG + Intergenic
1152422847 17:80203496-80203518 CAATATTCATGGTGGGTCCCTGG - Intronic
1154435134 18:14336727-14336749 CACCGGTCATGGAGGTCCCATGG - Intergenic
1161884496 19:6983360-6983382 CACCAGTCATGTAGGATTCAGGG + Intergenic
1162776214 19:12981240-12981262 CACCAGGCAAGGAGGGTCCAGGG + Intergenic
1166843183 19:45711457-45711479 CACCCTTCTCAGAGGGTCCACGG + Exonic
926827427 2:16920728-16920750 CAACATTCATGGAGGGTTTCTGG - Intergenic
928490356 2:31777562-31777584 CATCTCCCATGGAGGGTCCAGGG + Intergenic
929045442 2:37784674-37784696 CAGCATTTATGGAGGCTCCAAGG - Intergenic
931627429 2:64269471-64269493 CATCATTCATGTAAGGCCCATGG - Intergenic
939416569 2:141906300-141906322 CACAAATTATGGAGTGTCCATGG + Intronic
942689063 2:178565989-178566011 CATCATTGATGGAGGGGCAAAGG - Exonic
943664186 2:190591179-190591201 CATCATACTTAGAGGGTCCAGGG + Intergenic
946221231 2:218228908-218228930 TGCCATTCATGGAAGATCCATGG + Intronic
1176300519 21:5096887-5096909 CACCACTCATGGGTGGTCCCCGG + Intergenic
1179856524 21:44165094-44165116 CACCACTCATGGGTGGTCCCCGG - Intergenic
1180000278 21:44992457-44992479 CACCTTCCATGGCGGGACCAGGG - Intergenic
1181778200 22:25175008-25175030 CACCTTTCATGGAGGTCCCAGGG + Intronic
950223678 3:11216112-11216134 CACCATTCAGGGAGTGTTCAGGG - Intronic
952016073 3:28958947-28958969 CCCCATTTCTGCAGGGTCCAGGG + Intergenic
960963551 3:123089384-123089406 AACCACTTAGGGAGGGTCCAAGG + Intronic
970413542 4:15834483-15834505 GAACATTCTTAGAGGGTCCATGG + Intronic
974673323 4:65058669-65058691 CAAGCTTCATGCAGGGTCCATGG - Intergenic
978567203 4:110095782-110095804 GACCATAATTGGAGGGTCCAGGG + Intronic
979441222 4:120751672-120751694 GACCTTTCATGGAGAGACCAGGG - Intronic
987294486 5:16537866-16537888 CACCCTGCATGCAGGGTCCATGG + Intronic
987673976 5:21050753-21050775 CCTCAATCATGGAAGGTCCATGG + Intergenic
989142065 5:38211217-38211239 CACCATTCATGGAGGTGACTGGG + Intergenic
994196064 5:96924273-96924295 CACCATTTATGGAGGGCCCCTGG - Intronic
996482751 5:123993540-123993562 CAATATCCATGGAGGATCCAAGG + Intergenic
998128510 5:139639485-139639507 CACCACACATGCAGGGGCCAGGG - Intergenic
999240411 5:150124388-150124410 GCCCAGTCATGGAGGCTCCATGG + Intronic
999819415 5:155210623-155210645 TACCACTCATGCAGGGGCCAAGG - Intergenic
1003145906 6:3510625-3510647 CACCATTCATAGAGTGCTCACGG + Intergenic
1006739184 6:36295125-36295147 CACCATTCATGGTGGAGCCTCGG - Intronic
1007420606 6:41716973-41716995 CACCCTTCATGGAGGGTGGCCGG - Intronic
1017005037 6:150023609-150023631 CATCATTCATGGATTGTCTATGG - Intronic
1018232462 6:161688741-161688763 CACCACTCAGTGAAGGTCCATGG + Intronic
1018568917 6:165186546-165186568 CACGATTCATCGAGGGTGCATGG - Intergenic
1019924840 7:4185372-4185394 CACTATTCATGGATGGGCCCTGG + Intronic
1023833116 7:44051755-44051777 CTCCCTTCATGGTGGGACCAGGG + Intronic
1029406205 7:100375244-100375266 CCCCATTCATTGAGGCACCATGG + Intronic
1030505772 7:110420379-110420401 CACAATTAATGGAGGTCCCACGG - Intergenic
1031374145 7:121003998-121004020 TCCTATTCATGGAGGGACCATGG - Intronic
1034455145 7:151166227-151166249 CACCATTCATGGAGGGTCCAGGG + Intronic
1037633140 8:20676566-20676588 CACCATTGGTGGAGGGACCCAGG + Intergenic
1045911977 8:107420693-107420715 CAGCATTCATATATGGTCCATGG + Intronic
1046012209 8:108562928-108562950 CACCATTCAGGATGTGTCCAAGG + Intergenic
1049563574 8:143325659-143325681 CACAATCCATGGAGGTTGCAGGG + Intronic
1052538952 9:29781778-29781800 CTCCATTCATGTATGGTCCAGGG + Intergenic
1056912568 9:90716178-90716200 AACCATTCATAGAGGATCCATGG - Intergenic
1059335824 9:113567811-113567833 CACCATCCCAAGAGGGTCCAGGG - Intronic
1185956222 X:4493823-4493845 CATCTTTTACGGAGGGTCCACGG + Intergenic
1195663490 X:107405963-107405985 TTCTATTCATGGAGGTTCCAAGG - Intergenic
1200850793 Y:7881099-7881121 CACCATTAATGCAGGGCCAAGGG + Intergenic
1201744538 Y:17357280-17357302 CATCTTTTATGGAGAGTCCATGG + Intergenic
1202381255 Y:24277786-24277808 CACAATTCATGGAATGTACAGGG + Intergenic
1202489530 Y:25392340-25392362 CACAATTCATGGAATGTACAGGG - Intergenic