ID: 1034459613

View in Genome Browser
Species Human (GRCh38)
Location 7:151191280-151191302
Sequence CTGCAGGTGTGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 1, 2: 4, 3: 79, 4: 658}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034459613_1034459631 27 Left 1034459613 7:151191280-151191302 CCCTCTTCCCTCCACACCTGCAG 0: 1
1: 1
2: 4
3: 79
4: 658
Right 1034459631 7:151191330-151191352 CCTTGGCAGGGGCACTGACTCGG No data
1034459613_1034459627 16 Left 1034459613 7:151191280-151191302 CCCTCTTCCCTCCACACCTGCAG 0: 1
1: 1
2: 4
3: 79
4: 658
Right 1034459627 7:151191319-151191341 CCCAAGGCCATCCTTGGCAGGGG No data
1034459613_1034459633 29 Left 1034459613 7:151191280-151191302 CCCTCTTCCCTCCACACCTGCAG 0: 1
1: 1
2: 4
3: 79
4: 658
Right 1034459633 7:151191332-151191354 TTGGCAGGGGCACTGACTCGGGG 0: 1
1: 0
2: 1
3: 6
4: 157
1034459613_1034459632 28 Left 1034459613 7:151191280-151191302 CCCTCTTCCCTCCACACCTGCAG 0: 1
1: 1
2: 4
3: 79
4: 658
Right 1034459632 7:151191331-151191353 CTTGGCAGGGGCACTGACTCGGG 0: 1
1: 0
2: 1
3: 28
4: 222
1034459613_1034459624 14 Left 1034459613 7:151191280-151191302 CCCTCTTCCCTCCACACCTGCAG 0: 1
1: 1
2: 4
3: 79
4: 658
Right 1034459624 7:151191317-151191339 TTCCCAAGGCCATCCTTGGCAGG No data
1034459613_1034459623 10 Left 1034459613 7:151191280-151191302 CCCTCTTCCCTCCACACCTGCAG 0: 1
1: 1
2: 4
3: 79
4: 658
Right 1034459623 7:151191313-151191335 TGCATTCCCAAGGCCATCCTTGG No data
1034459613_1034459634 30 Left 1034459613 7:151191280-151191302 CCCTCTTCCCTCCACACCTGCAG 0: 1
1: 1
2: 4
3: 79
4: 658
Right 1034459634 7:151191333-151191355 TGGCAGGGGCACTGACTCGGGGG 0: 1
1: 0
2: 0
3: 44
4: 195
1034459613_1034459625 15 Left 1034459613 7:151191280-151191302 CCCTCTTCCCTCCACACCTGCAG 0: 1
1: 1
2: 4
3: 79
4: 658
Right 1034459625 7:151191318-151191340 TCCCAAGGCCATCCTTGGCAGGG No data
1034459613_1034459620 0 Left 1034459613 7:151191280-151191302 CCCTCTTCCCTCCACACCTGCAG 0: 1
1: 1
2: 4
3: 79
4: 658
Right 1034459620 7:151191303-151191325 CCCTCTCTCCTGCATTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034459613 Original CRISPR CTGCAGGTGTGGAGGGAAGA GGG (reversed) Intronic
900176833 1:1294817-1294839 CTGCAGGTCCGCAGGGAAGGGGG + Intronic
900242086 1:1621958-1621980 CTGCAGGTGAGCAGTGAGGAGGG - Intronic
900484159 1:2913640-2913662 CTCCAGGGGTGGTGGGAGGAAGG - Intergenic
900500804 1:3003639-3003661 CTGCAGCTGTGGAGGCAGCACGG - Intergenic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
900819845 1:4878259-4878281 ACACAGGTGTGGAGTGAAGAGGG + Intergenic
900888314 1:5430938-5430960 CGGCAGGTGTGGGGGGATGGTGG - Intergenic
900912778 1:5613680-5613702 CTGCTGGTGGGAATGGAAGATGG - Intergenic
901323052 1:8350946-8350968 CTGCAGGTGGGCTAGGAAGATGG - Intergenic
901436606 1:9250605-9250627 CTGCAGGGGTGGAGAGCAGCTGG - Intronic
901451219 1:9338031-9338053 CAGCTGGGGTGCAGGGAAGAGGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901849588 1:12007047-12007069 CTGCAGGTGTGGAAGGCAGTGGG + Exonic
902396021 1:16132850-16132872 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902396059 1:16132979-16133001 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902396083 1:16133066-16133088 GTGCAGGTGTGGGGGGAAGGTGG + Intronic
902611891 1:17602575-17602597 CAGCAGGGGTGGGGGAAAGAGGG + Intronic
902623782 1:17665126-17665148 CTGCAGGTGTGAAGGTGAGCGGG - Intronic
902737245 1:18409237-18409259 CTGCAGGTGGGAGGGGAAGTAGG - Intergenic
902951950 1:19891596-19891618 TTGGAGGTGAGGAGGGGAGAGGG + Intronic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
903231064 1:21922633-21922655 GTGGAGGTGTGGGGGGAAGGAGG + Intronic
903332280 1:22602305-22602327 CTCCAGGTGTGGGGGGACGTAGG - Exonic
903745700 1:25585287-25585309 CAGCAGGTGTGTGGGGAAGCCGG + Intergenic
903917326 1:26773893-26773915 CAGCAGGTGAGGAGGGTAGCTGG + Exonic
904037511 1:27566806-27566828 CTGCTAGGGTGGGGGGAAGAAGG + Intronic
904304083 1:29575797-29575819 CTGGAGGAGGGCAGGGAAGAGGG - Intergenic
904437069 1:30506009-30506031 CTGGAGGTGTGCACAGAAGATGG - Intergenic
904456380 1:30650620-30650642 CCCCAGGTGGGGAGAGAAGAGGG - Intergenic
904472079 1:30742237-30742259 CTGCAGGTGGTGAGAGCAGATGG - Intronic
905336058 1:37245349-37245371 CTGCAGGTGGGGCTGGGAGAAGG - Intergenic
905516326 1:38564642-38564664 TGGCAGAGGTGGAGGGAAGAAGG + Intergenic
905688590 1:39926511-39926533 CTGCTGATGTGGAGGAGAGATGG - Intergenic
905807447 1:40887111-40887133 AAGCAGGTCTGCAGGGAAGAGGG + Intergenic
905897392 1:41557669-41557691 CTCCAGGGGTGGGGGGCAGAGGG + Intronic
906345331 1:45011049-45011071 CTGCCGGTGTGGGAGGCAGAGGG - Exonic
907309103 1:53529278-53529300 CTGCAGGTGAGGAGCGGAGGTGG - Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907611117 1:55872170-55872192 CTCCATGTGTGGAGGGAGGGAGG - Intergenic
907870429 1:58437987-58438009 CTGCACATATGGAGGGAACATGG - Intronic
909044939 1:70698540-70698562 ATGAATCTGTGGAGGGAAGATGG + Intergenic
909848982 1:80435576-80435598 ATGCAGGGGAGGATGGAAGATGG - Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
912814134 1:112815451-112815473 GTGAAGGTGAGGAGGGGAGAAGG - Intergenic
912977248 1:114341834-114341856 CTGCAAGGGTGGGTGGAAGAGGG + Intergenic
912999473 1:114565212-114565234 CTGCAGGCGTGTAGGGGGGACGG - Intergenic
914003560 1:143713020-143713042 AGGCAGCTGAGGAGGGAAGAAGG - Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914991381 1:152502224-152502246 ATGCAGGAGTGGAGGAAAAAGGG + Intergenic
915346747 1:155201384-155201406 CTTCAGGCGTGGAAGGAAAAGGG - Intronic
916178104 1:162059766-162059788 CTGCTTTTGTGGAGGGAAGGTGG - Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917112483 1:171563171-171563193 CTACAGATGTGGAGAGAAAATGG - Intronic
917273623 1:173305862-173305884 CCGCACATGTGGAGGGAAGGAGG - Intergenic
917748586 1:178034702-178034724 CACCAGGTGTGAAGGGAAGATGG + Intergenic
918429454 1:184443872-184443894 CTGCTGGGGAGGAGGTAAGAAGG + Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920146082 1:203861950-203861972 CTTCAGGTGCGGAGTGAAAACGG + Intronic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920539736 1:206769323-206769345 CCGCAGGTGCGAAGGGCAGATGG + Intronic
920742369 1:208593470-208593492 GGGCAGGAGTGGAGGAAAGAGGG + Intergenic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
922697823 1:227740451-227740473 GTCCAGGTGTGGAGGGAGGGAGG + Intronic
922769135 1:228172735-228172757 CTGCTGGTGGGGAGGCAAAACGG - Intronic
923326995 1:232888774-232888796 CTGCAGGTAAGGAGTGAACAAGG + Intergenic
923361162 1:233212539-233212561 ATGCAGTTGTCCAGGGAAGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923608171 1:235464417-235464439 AGGGAGGGGTGGAGGGAAGAAGG - Intronic
923678457 1:236100182-236100204 ATGCAGAGGTGGTGGGAAGAAGG - Intergenic
1063502026 10:6563842-6563864 GTGCAGTTGGGGAGGGAGGAAGG + Intronic
1064021770 10:11814749-11814771 CTGGAGGTTTGGCGGGAAGCTGG + Intergenic
1064091045 10:12385145-12385167 CTGCTGGTGTGGATGTAAAATGG + Intronic
1065264465 10:23960234-23960256 CTGCAGGGGAGAAGGGAAGGAGG + Intronic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066022598 10:31318960-31318982 CCTCAGGTGTGGTGGGGAGAGGG - Intronic
1066299262 10:34082408-34082430 CTGCAGGTGGGGATGTAAAATGG + Intergenic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067545270 10:47188237-47188259 GTGGAGGTGGGGAGAGAAGAGGG + Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1068080522 10:52313534-52313556 GATCAGGGGTGGAGGGAAGAGGG - Intergenic
1068087761 10:52395877-52395899 CTGTAGGTGTGCACAGAAGAGGG - Intergenic
1069302583 10:66927027-66927049 CTGTAGGTGTGAAGGCAAAATGG + Exonic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070817881 10:79336514-79336536 GGGGAGGTGTGGGGGGAAGAGGG + Intergenic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1072015554 10:91342876-91342898 CCCCATGTGTGGAGGGAGGAGGG - Intergenic
1073989790 10:109249632-109249654 CTTCAGGAGTGGAGAGAGGAGGG + Intergenic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1074885396 10:117689159-117689181 CCCCAGTTGTGGAGGGAGGAAGG - Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076408110 10:130226784-130226806 CAGCAGGGGAGGAAGGAAGATGG + Intergenic
1076618546 10:131772197-131772219 CGCCAGGTGTGGAGGGCACAGGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076838442 10:133032819-133032841 CTGCAGGTGTGCAGAGAGCAGGG + Intergenic
1077063070 11:626182-626204 CTGCAGGTGTAAAGGGCAGCTGG + Intergenic
1077089775 11:773173-773195 CAGCAGGGGTGCAGGGAGGAAGG - Intronic
1077214959 11:1391346-1391368 GGGCAGGGGTGGAGGGAAGGAGG + Intronic
1077292424 11:1804121-1804143 CGGCAGGTGTGGAGGGCGGCGGG + Intergenic
1077503157 11:2918263-2918285 CTGCAGGTGTGCAGTGTAGAGGG - Intronic
1078187206 11:9062165-9062187 CTGAAGGAGTTGGGGGAAGAGGG - Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1079085668 11:17443117-17443139 CTGCTGCTGTCGAGGGAAGGAGG + Intronic
1079321590 11:19455995-19456017 CTGCAGAGGGGGAGGGAAGGAGG + Intronic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1079344479 11:19639944-19639966 CAGCATGGGTGAAGGGAAGATGG + Intronic
1079710833 11:23680424-23680446 CTGCAGCTATGAAGGGAAGTGGG + Intergenic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1081877532 11:46419804-46419826 ATGAAGGTGGGGAGGGAGGAAGG + Intronic
1082002891 11:47403462-47403484 CTGCTGGTGGCAAGGGAAGAGGG + Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083259954 11:61517521-61517543 ATGGAGGGGTGGAGGAAAGAAGG + Intronic
1084147057 11:67270553-67270575 CTGCAGGAGTGAAGGAAGGAGGG - Intronic
1084273365 11:68040334-68040356 CTGCAGGTGGGCAGGGCAGGGGG - Intronic
1084322524 11:68381551-68381573 CTGCATGCGTGCAGGGAGGAAGG + Intronic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1084699752 11:70778802-70778824 CTGCCAGTGTGGAGGGCAGTAGG - Intronic
1084906778 11:72354605-72354627 ATGCAGGTGTGGTGGGAGGGAGG - Intronic
1084919868 11:72460265-72460287 CTGCAAGTGTTCAGGGAAGCGGG + Intergenic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085777542 11:79380093-79380115 CTGCATGTGTTGGGGGAAGGAGG - Intronic
1085961656 11:81469227-81469249 TTACAGGTGTGAAGGGGAGATGG + Intergenic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1087271517 11:96116626-96116648 CTGCAGGATTGGGAGGAAGAAGG + Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087793656 11:102433025-102433047 CTGCAGGTGTGGAGGCCTCATGG + Intronic
1088540760 11:110911273-110911295 CTGCTGGTGCAGAGGGGAGAGGG + Intergenic
1088678147 11:112216214-112216236 TTGCAGGTTTGGAGAGAAGATGG + Exonic
1088713258 11:112527027-112527049 CTCCAGATGTCTAGGGAAGAAGG + Intergenic
1088795121 11:113261158-113261180 GTTCAAGTGTGGTGGGAAGACGG + Intronic
1089402614 11:118173083-118173105 CTGGAGGTGAGGAGTGATGAGGG - Intronic
1089613289 11:119681458-119681480 CTGAAGGTGTGGAGGCAGGCAGG + Intronic
1089777967 11:120852231-120852253 CTGCTGCTGAGGAGGTAAGAGGG + Intronic
1089958885 11:122598429-122598451 CTGCAGGTTTGCAGGGAACGGGG + Intergenic
1090373664 11:126274313-126274335 AGGCAGGAGTGGAGGGAACAAGG + Intronic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091446009 12:544458-544480 AGGCAGGTGTGGAGGGAGGTGGG - Intronic
1091670651 12:2449857-2449879 CTGCAGGTGTGGGGTGAGGGTGG + Intronic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1092135758 12:6145894-6145916 CTGCAGCTGAGGAGTGGAGATGG - Intergenic
1092727517 12:11500005-11500027 CTGCAGGTCTGGTGGGATGTGGG - Intronic
1093084727 12:14854127-14854149 TGGCAGCTGAGGAGGGAAGATGG - Intronic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094137182 12:27140185-27140207 CTGGAGGTGTGCAAGGAAGGCGG + Intergenic
1094524537 12:31222914-31222936 CTGCAGGTCTGGTGGGATGACGG + Intergenic
1095995972 12:48085054-48085076 CTGCAGGGATGGCGGGGAGAAGG + Intronic
1096240610 12:49958024-49958046 CTCCAGGGGTGGAGGGAAATTGG + Exonic
1096745657 12:53725309-53725331 CTGGAGCTGTGGGGGGAAGGAGG - Intronic
1096752192 12:53767766-53767788 CTGCAGGTCTGGTAGGGAGAAGG + Intergenic
1096758391 12:53818862-53818884 GTCCAGCTGTGGAGGGAGGATGG - Intergenic
1096773875 12:53952507-53952529 CTGCTGGGGTGGAGGGAATGGGG + Intergenic
1096799041 12:54097239-54097261 CCACAGGTGTAGAGGGAAGGAGG - Intergenic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1096873316 12:54608451-54608473 TTGCTGGGGTGGAGGGGAGAGGG - Intergenic
1097261145 12:57720863-57720885 CTCCAGGTGGGGAGGGCACAGGG + Exonic
1098065264 12:66608012-66608034 CAGCAGGTGGGGAGGGAGGCAGG + Intronic
1100790340 12:98123424-98123446 TTGCAGGGGAGGAGGGAATAGGG - Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101055345 12:100906766-100906788 CTGAAGGTGTTTGGGGAAGAGGG + Intronic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101980829 12:109405718-109405740 CTTCAGGTGCTAAGGGAAGAGGG - Intronic
1102214574 12:111151578-111151600 CTGAATGCGTGGAGGGCAGACGG + Intronic
1104076106 12:125391553-125391575 CTGCAGGTCTGCAGGGGAGTAGG - Intronic
1104636632 12:130441770-130441792 CTGCTAGTGGGGAGGGAAGGTGG - Intronic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105285102 13:18996950-18996972 CAGAAGGTGTGAAGGCAAGAAGG + Intergenic
1105644890 13:22306531-22306553 CAACAGATGTAGAGGGAAGATGG - Intergenic
1106507402 13:30383109-30383131 CACCAGGTGTGGTGGGAAGCAGG + Intergenic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1107103034 13:36614475-36614497 CTGAAGGTGTGCAGTGAGGATGG - Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108482310 13:50886426-50886448 GTTCAGGGATGGAGGGAAGAGGG + Intergenic
1108980660 13:56508820-56508842 CTGCAGGTAGGCAGGAAAGAAGG + Intergenic
1109718371 13:66246199-66246221 CTGCAGGAGTGGAGCACAGATGG + Intergenic
1110002610 13:70224126-70224148 CTGCAGGCTTGAAAGGAAGATGG + Intergenic
1110542441 13:76721188-76721210 CTGCATGGGTGGAGGGGATATGG - Intergenic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1112006196 13:95255755-95255777 GTGCAGGTGTGGAGGGGGGTTGG - Intronic
1112227664 13:97555904-97555926 CTGCAGGTGTGGATGGATGGTGG + Intergenic
1112422754 13:99268022-99268044 CAGCTGGTGTGGAAGAAAGAAGG + Intronic
1113252253 13:108466721-108466743 CTGAAGGTTTGGCGAGAAGAAGG + Intergenic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1113483286 13:110637157-110637179 CCGCAGGTGTGGAGGGCAAGGGG + Exonic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114258965 14:21024331-21024353 GTGCTGATGTGGAGGTAAGAGGG + Exonic
1114345815 14:21793678-21793700 CATCAGGTGTGGAGGGTAGATGG + Intergenic
1114559347 14:23579077-23579099 AAGCAGGGGAGGAGGGAAGAAGG + Intergenic
1114653493 14:24301717-24301739 TTGCAGGTAAGGAGGGAAGTAGG + Exonic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1115335460 14:32240737-32240759 CTGCAGGGGAGGAGCCAAGATGG - Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1116841883 14:49827062-49827084 ATGCAGGTGTTGAGGTCAGAGGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118147447 14:63155922-63155944 CTTCAGGAGTGAAAGGAAGAAGG + Intergenic
1118835245 14:69473351-69473373 CTGCAGCTGGGGCGGGGAGAGGG - Intergenic
1119405639 14:74397120-74397142 CTGCAAGTGTGAAGGGCTGAAGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119709258 14:76809505-76809527 CTGCAGCAGTGGCGAGAAGAAGG - Exonic
1120613108 14:86666948-86666970 GTGCAGGTGTGCAGGGATGGTGG - Intergenic
1120922999 14:89772130-89772152 TTGCAGGAGTCCAGGGAAGATGG - Intergenic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121244297 14:92451175-92451197 CAGAAAGTGTGGAGGGAAGTGGG + Intronic
1121445167 14:93974042-93974064 CTGCAGGTGAGGAGGGGCTATGG - Intronic
1121553909 14:94822114-94822136 CCGAAGCTGTAGAGGGAAGATGG + Intergenic
1121610352 14:95274486-95274508 CTGCAGCTGTGCTGGGCAGAGGG - Intronic
1121684861 14:95828161-95828183 ATGCTGGGGTGGAGGAAAGAAGG + Intergenic
1121787227 14:96671208-96671230 CTGCAGCTTTGGAGGGAAAGGGG - Intergenic
1122155716 14:99749259-99749281 CCGCAGGTGGGAAGGGAAAATGG - Intronic
1122774562 14:104111530-104111552 CTGCAGGTGTGGTGGCAGGCAGG + Exonic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1123993363 15:25701291-25701313 GTGCAGGTGTGGACCTAAGAGGG + Intronic
1124561042 15:30773869-30773891 CTGCGAGTGGGGATGGAAGAAGG - Intergenic
1124669488 15:31625190-31625212 CTGCGAGTGGGGATGGAAGAAGG + Intronic
1125777499 15:42230246-42230268 CTGCAAGCGTTGAGAGAAGAGGG - Intronic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1127581552 15:60343417-60343439 CGCCACGTGTGGAGGGAAGGAGG - Intergenic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1128529636 15:68435546-68435568 CTGCAGGTGTGGCTGGATCAAGG + Intergenic
1128882062 15:71252995-71253017 CTGCAAGCCTGGAGGGCAGAGGG - Intronic
1129227614 15:74179147-74179169 CTCCAGGTGTGGAGGTAGGAAGG - Intergenic
1129556222 15:76512587-76512609 CTGCAGAAGTGGAGGGGAAAAGG + Intronic
1129606603 15:77028169-77028191 CTCCAGGGGTGGAGGGAGGAGGG + Intronic
1129683316 15:77670774-77670796 CTGCTGCTGGGCAGGGAAGATGG + Intronic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130655932 15:85792235-85792257 GTGCAGGGGAGGAGGGAGGAGGG - Intronic
1131841842 15:96445705-96445727 GTGCCGGTGGGGAGGGATGAGGG + Intergenic
1132356096 15:101172596-101172618 CTGCAGGGGTGTAGGGGTGAGGG - Intergenic
1132362126 15:101225171-101225193 TTGGAGGTGAGGTGGGAAGATGG - Intronic
1132599093 16:765990-766012 CAGGAGGTGTGGGAGGAAGAAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133084028 16:3347523-3347545 GTGGAGGTGTGGACGGAGGAGGG - Intergenic
1133985367 16:10664264-10664286 CTGCAGGGAGGGAAGGAAGAGGG + Intronic
1134792011 16:16997596-16997618 TGGGAGGCGTGGAGGGAAGAGGG - Intergenic
1134865858 16:17606147-17606169 CCTCAGGTGTGAGGGGAAGAGGG - Intergenic
1134884591 16:17778433-17778455 GTGCAGGTGTAGAAGAAAGAAGG - Intergenic
1135052655 16:19205027-19205049 CTGCAGGTGAGAAGTGAAGGTGG - Intronic
1135828131 16:25748443-25748465 CTGCAGGTGTGGGGGTGGGAAGG - Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1137053845 16:35734331-35734353 CCGCAGGGGTGGAGGCAAGCGGG - Intergenic
1137975878 16:53031581-53031603 CTGCAGGAGAGGAGAGAGGAAGG + Intergenic
1138008649 16:53358803-53358825 GTGCAGGTGGGGAGAGCAGAAGG + Intergenic
1138458851 16:57136131-57136153 ATGCAGGTGGGTATGGAAGAGGG + Intronic
1138468015 16:57207966-57207988 CTGGAGGTGTGGAGGTAAAAAGG - Intronic
1138659306 16:58508247-58508269 GTGCTGCTGGGGAGGGAAGAGGG - Intronic
1138789088 16:59881318-59881340 CTGCAGGTTTGGAAGGGTGAGGG + Intergenic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1140962268 16:79927696-79927718 CTGCAGAGGTGTAGGCAAGAGGG - Intergenic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1141848385 16:86626811-86626833 CTGCAGATGTGGGGAGAAGAGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141858468 16:86700909-86700931 CTGCAGGTGGCGGGGGACGAGGG - Intergenic
1142015116 16:87741550-87741572 CCGCTGGTGGGGAGGGATGACGG - Intronic
1142234385 16:88915007-88915029 GGGCAGGGGTGGAGGGAGGAAGG + Intronic
1142252780 16:89000350-89000372 CAGCACGTGTGAAGGGAAGCAGG + Intergenic
1142623138 17:1177567-1177589 CTCCAGGCGTGGGAGGAAGAGGG + Intronic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1142878712 17:2868129-2868151 CTGCTGGGGTGGAGGGCAGCTGG - Intronic
1142990754 17:3729210-3729232 ATGACGCTGTGGAGGGAAGAAGG - Intronic
1143583193 17:7838288-7838310 CTGCTGGTGGGGAGGGAGGGAGG + Intergenic
1143766774 17:9143060-9143082 CTGGAGGTGATGAGGGATGAAGG + Intronic
1143854285 17:9837232-9837254 GTGGAGGTGGGGAGGGATGATGG - Intronic
1143968355 17:10773728-10773750 CTGAAGGAGTGAAGGTAAGATGG - Intergenic
1144433017 17:15212514-15212536 CTGCAGGGGTGAAGGGGAGATGG + Intergenic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1145261203 17:21355812-21355834 CTGCCTGTGTGGAGAGATGATGG + Intergenic
1145272047 17:21410030-21410052 AGGCTGGTGTGGAGGGGAGAGGG - Intronic
1145310256 17:21697493-21697515 AGGCTGGTGTGGAGGGGAGAGGG - Intronic
1145371233 17:22307937-22307959 CTGCAGGGGTGTGGGGTAGATGG + Intergenic
1146004957 17:29155330-29155352 CTGCATGTGTGGTGGGGAGGAGG - Intronic
1148140136 17:45322389-45322411 CTGCAAGTGTGGCAAGAAGATGG + Intergenic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148785871 17:50145969-50145991 CTGCAGTTGTGGAGGGAGAGCGG - Intronic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1149208436 17:54276336-54276358 TTGGAGGTGTGGGGGGCAGAGGG + Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150216734 17:63475588-63475610 CTGCAGGTCAGGAGGGAGGCTGG + Intergenic
1150615450 17:66767349-66767371 CTGCTGGTACGGAGTGAAGACGG + Intronic
1150781585 17:68127399-68127421 TTGCAGTTGTGGAAGGCAGAAGG + Intergenic
1151175223 17:72282520-72282542 CAGCAGGTGGGAAGGGGAGAGGG - Intergenic
1151213891 17:72564326-72564348 GGGCAGGTATGGAGAGAAGAAGG + Intergenic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151733589 17:75925194-75925216 CTGCAGGTGCTGAAGGAAGCGGG - Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152044932 17:77929567-77929589 CTGCAGGTATTGAGGCCAGAAGG + Intergenic
1152058259 17:78049709-78049731 TTGCAGGTGGGGCGGGATGATGG - Exonic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152286475 17:79415913-79415935 CTGCAGGTGAGGAGGTGGGAGGG - Intronic
1152336945 17:79703951-79703973 CTGCAGGAGTGGGGGGTAGGAGG + Intergenic
1152600536 17:81260030-81260052 CTGCCTGTGTGCAGGGAACATGG - Intronic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154311025 18:13266281-13266303 ATGCAGGGCTGGAGGGCAGAGGG - Intronic
1154528259 18:15314764-15314786 CTTTAGATGTGGAGGGAAAAGGG + Intergenic
1154929570 18:20978760-20978782 CTTGAGGTGGGGAGGAAAGAAGG + Intronic
1156366645 18:36434001-36434023 CTACAGGTGGGGAGCGGAGAGGG - Intronic
1156585444 18:38426347-38426369 CTGCATGTGTTGGGGGAAGATGG + Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157274504 18:46301391-46301413 CAGCAGGTGTGTGGGGGAGATGG + Intergenic
1157564072 18:48668069-48668091 CTGCAGGTTTGGAGGGCTGAAGG - Intronic
1157581537 18:48776759-48776781 CTGCGGGTGGGAAGAGAAGATGG + Intronic
1158479526 18:57808485-57808507 GTGCAGGTCAGGAAGGAAGAGGG - Intergenic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159138609 18:64365969-64365991 GTGGAGGTGGGGAGGGTAGAAGG + Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159817811 18:73098704-73098726 GAGCAGTTGTGGAGGGAAGCTGG - Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160872219 19:1282593-1282615 GTGAAGGTGTGAAGGGAGGAGGG + Intergenic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161186753 19:2926556-2926578 CTGCCGGTGTGGGGGACAGAGGG - Intergenic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161952951 19:7477734-7477756 TGGGAGGTGTGGAGGGAAGGGGG + Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163054237 19:14706360-14706382 GTTGAGGGGTGGAGGGAAGATGG - Intronic
1163113980 19:15178348-15178370 CTGGAGGTTTGAAGGGAAAAGGG - Intronic
1163577935 19:18121668-18121690 CGGCAGCTGTGGGGGGAAAAGGG - Exonic
1164004225 19:21134224-21134246 ATGCAGGTTAAGAGGGAAGAAGG + Intergenic
1164634726 19:29784191-29784213 CTGAAGGTGTGGGGAGAAGAGGG + Intergenic
1164816025 19:31204137-31204159 CTCCACATGTGGAGGGAAGGAGG - Intergenic
1164834598 19:31349415-31349437 CCGAACGTGCGGAGGGAAGAAGG + Exonic
1165329216 19:35132037-35132059 ATGAAGCTGTGGAGGGAAGCTGG + Exonic
1165521629 19:36318892-36318914 CTGCAGGGGTGTGGGGTAGATGG + Intergenic
1165634140 19:37326334-37326356 CTGCAGGGGTGTGGGGTAGATGG - Intronic
1165799958 19:38543430-38543452 CTGCAGGTGAGGACGTGAGACGG + Exonic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166178409 19:41090381-41090403 CTGCAGGTGTGGCGGGAGAAGGG - Intronic
1166750277 19:45161216-45161238 CTGCTGGTGTGGGGGGGACAGGG + Intronic
1166948260 19:46410444-46410466 CTGCTGGTTTGGAGGGGACAGGG - Exonic
1167685215 19:50951686-50951708 CTGCACCTGTGGAGGCAACATGG - Intronic
1167694531 19:51007001-51007023 CTCCAGGTGAGTAGGGAGGAAGG - Intronic
1167712909 19:51123338-51123360 CTGCAGGTGTGGAGGGCCCCAGG + Intergenic
1167801355 19:51744686-51744708 CTGGAGGTGAGGAGATAAGAGGG + Intergenic
1168331860 19:55575042-55575064 TTCCAGGAGTGGAAGGAAGAGGG - Intergenic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
1168588995 19:57617191-57617213 CTGCAGGTTTGGAGCTAGGAGGG + Intronic
925042610 2:744615-744637 CCGGAGGTGAGAAGGGAAGAGGG - Intergenic
925180296 2:1813171-1813193 CTGCAGGTGGGGGGGAGAGAGGG + Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925407139 2:3613161-3613183 CTGCAGGCGGGGAGGGAGGTAGG + Intronic
925441906 2:3895319-3895341 CTGCAGCTGCTGTGGGAAGATGG + Intergenic
926593764 2:14767669-14767691 CAGCAGGTGCGGACGTAAGAAGG - Intergenic
926629503 2:15123751-15123773 CTGCAGGTGTACAGGAAACAGGG - Intergenic
926809897 2:16746659-16746681 AGGGAGGTGGGGAGGGAAGACGG - Intergenic
926835653 2:17016598-17016620 CAGCAGGTGTGGAATGAAGTGGG - Intergenic
927358041 2:22196599-22196621 CTGCAGATTTGGAGGGATGGTGG - Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927849745 2:26491360-26491382 GTGGAGGGGTGGAGGGAAAAAGG + Intronic
927888004 2:26730360-26730382 TTGCAGGTGTGGTGGGCAGAGGG - Exonic
928098876 2:28423308-28423330 CTGCAGGTGTGCAGGAAAGGTGG + Intergenic
928201627 2:29251088-29251110 CTACAGGTGCGTATGGAAGAGGG - Exonic
928467445 2:31535616-31535638 GTCCAGGTGTGAAGGGGAGAGGG - Intronic
929949111 2:46392923-46392945 CTGGAGGTGAGGAGGGGTGAAGG + Intergenic
930108490 2:47658335-47658357 CTCCAGGTCTGGAGGGGAGGCGG - Intergenic
930235425 2:48884588-48884610 CTGCAGGTGTGGTCGGGGGAAGG - Intergenic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
931442977 2:62304408-62304430 CTTCAGGTGTGGAGGGAGGAGGG - Intergenic
931847539 2:66220105-66220127 GTCCAGGTGTTGAGGGATGATGG - Intergenic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
932772009 2:74505720-74505742 CTGCAGGTGAGAAGGGCTGAGGG - Exonic
932835385 2:75031142-75031164 ATGCTGGTGTGGAAGGAAGAGGG - Intergenic
933645258 2:84807571-84807593 GTGCAGGTGAGCAGGGAAGTGGG + Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934708062 2:96498435-96498457 CTCCTGGTGTGGCTGGAAGAGGG + Exonic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935657975 2:105441172-105441194 CTACAGGTGTCCAGGGAAGAGGG + Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
936032518 2:109083750-109083772 CTGCAGGTGGGAATGTAAGAGGG - Intergenic
936444691 2:112586352-112586374 CTGCAACTGTGGAGGTAAGAGGG + Exonic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937267423 2:120625283-120625305 GTGCAGCTGAGGAGGGCAGAGGG + Intergenic
937325225 2:120986255-120986277 CTGCAGGGGACGAGGCAAGAAGG - Intronic
937856024 2:126672536-126672558 CTGCAGGTGCTGAGGGGACAGGG - Intronic
938527363 2:132146227-132146249 CCTTAGGTGTGGAGGGAAAAGGG + Intergenic
941725799 2:168858781-168858803 CTGGAGGTGTGGGGGAGAGAGGG + Intronic
942288641 2:174447792-174447814 CTAGAGGTGAGGAGGGAGGAAGG + Intronic
942484942 2:176429036-176429058 CCCCACGTGTGGAGGGAAGGAGG + Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946159355 2:217826673-217826695 CTCCAGGATTGGAGGGAAGGAGG - Intronic
946577375 2:221090161-221090183 ATTCAAGTGTGGAGGGGAGAAGG + Intergenic
946841179 2:223821706-223821728 ATCCAGGTGTGGCTGGAAGATGG - Intronic
947444935 2:230156392-230156414 GTCCAGGTGAGGAGGGGAGATGG - Intergenic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948249118 2:236511485-236511507 CTGCAGGAGTGGAGGAGAGGAGG + Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948678041 2:239610639-239610661 CTGCAGGTGTGGATGCAGGGAGG + Intergenic
948716038 2:239864486-239864508 CTGCAGCTATGGAGGGTAGGGGG + Intergenic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
948757053 2:240165964-240165986 CTCCATGTGTGGAGGGAGGGAGG + Intergenic
948911067 2:241002949-241002971 CTGCAGGTGTCCAGGCAAGTGGG - Intronic
948914572 2:241026907-241026929 TTCCAGGTGTTGAAGGAAGAGGG - Intronic
948967096 2:241391330-241391352 CTGCAAATGTGCTGGGAAGATGG + Intronic
1169182619 20:3583227-3583249 TTGCAATTTTGGAGGGAAGAAGG - Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169359904 20:4939194-4939216 CACCAGGGGTGGAGGTAAGATGG - Intronic
1169523693 20:6400477-6400499 CTGCAGCTGTGGTAGGTAGATGG + Intergenic
1169583698 20:7056905-7056927 CTGCAAGTGTGGAAGAAAAATGG - Intergenic
1170182615 20:13549208-13549230 CTTGAGGAGTGGAGGGAATAGGG - Intronic
1171464810 20:25320000-25320022 CTGAAGGGGTTGAGGGAAGGCGG - Intronic
1171869566 20:30514239-30514261 CTGCAGGGGAGGGGGGAGGAGGG + Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1172102467 20:32493424-32493446 GTCCAGGTGTGGAGGGGAGTGGG + Intronic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1172617237 20:36297467-36297489 CTGAAGGTGTGGAGTGAGCAAGG - Intergenic
1172936252 20:38622680-38622702 CTGCAGGCATGGAGGGATGTGGG - Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173172599 20:40739701-40739723 AGGCAGGTGTGGAGGGAGGCGGG - Intergenic
1173552536 20:43942930-43942952 CTTCTGGTGTGGAGACAAGAAGG - Intronic
1173578969 20:44132835-44132857 CTGCAGGTGTGGGGGGCGGTGGG - Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174743626 20:53040331-53040353 TGGCTGGTGTGGAGGGAGGAGGG + Intronic
1175062811 20:56259192-56259214 GTGGAGGGGTGGTGGGAAGATGG - Intergenic
1175262118 20:57681289-57681311 CGGCAGGTTTGGAGGGACGGGGG - Intronic
1175773982 20:61641578-61641600 CTGTAGGTGTGGTGGGATCAGGG - Intronic
1175934700 20:62509474-62509496 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175934997 20:62510276-62510298 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175953872 20:62598068-62598090 CTGCTGGGGGGGATGGAAGATGG + Intergenic
1176769160 21:13053776-13053798 CTTTAGGTGTGGACGGAAAAGGG - Intergenic
1176993797 21:15529992-15530014 CTCCACGTGTGGAGGGAGGGAGG + Intergenic
1177284567 21:19033097-19033119 CTGCAGGTGTCAAGGGAGTAGGG + Intergenic
1178415861 21:32404630-32404652 CCAGAGGTGGGGAGGGAAGAGGG + Intergenic
1178529777 21:33366140-33366162 CTGCAGGCATTGAAGGAAGAGGG - Intergenic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1178943336 21:36925631-36925653 CTGCAGGGGTGGAGGGTGGGGGG + Intronic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179107517 21:38416272-38416294 CTGCAACTGTGGCAGGAAGACGG + Intronic
1179340859 21:40507885-40507907 ATGCAGGAGTGGAGGGGCGAGGG - Intronic
1179504549 21:41831827-41831849 CTGCAGGTGGGGTGGGATGTGGG - Intronic
1179515933 21:41906916-41906938 CTGCAGTTGTGGGGGCAAGGTGG + Intronic
1179799530 21:43804484-43804506 CAGCAGGTGTGAAGGGGAGAGGG - Exonic
1179978809 21:44885801-44885823 CAGCAGGTGAGGAAGGAAAAGGG + Intergenic
1179991494 21:44950486-44950508 CTGCAGGAGCGCAGGTAAGAAGG - Intronic
1180150394 21:45944222-45944244 GAGCAGGTGAGGAGGGGAGACGG + Intergenic
1180224934 21:46386615-46386637 CTGCAGGTGAGGAGGCACCAAGG - Intronic
1180613856 22:17114800-17114822 GTGCAGATGTGGGAGGAAGAAGG + Exonic
1180619631 22:17152420-17152442 ATACAGGGGTGGAGGGAAGAGGG + Intronic
1180883174 22:19221014-19221036 CTCCAGGTGGGGTGGCAAGATGG + Intronic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1181165504 22:20980969-20980991 CTGCAGGAGTGAGGGGAGGAGGG - Intronic
1181527776 22:23500043-23500065 GTGGAGGTGAGGCGGGAAGAGGG - Intergenic
1181552037 22:23645365-23645387 CCACAGGTGGGGAGGGAAGGAGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182150849 22:28026167-28026189 CCTCAGGTGTTGAGGGCAGAGGG + Intronic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183279766 22:36925733-36925755 AAGCAGGTGAGGAGGGAGGAAGG - Intronic
1183513282 22:38248386-38248408 CTGCAGCTGAGGATGGAAGTGGG - Intronic
1184266211 22:43347924-43347946 CTGCAGGTGTGAAGCAGAGATGG - Intergenic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184510446 22:44930242-44930264 CTGCCCCTGTGGAGGGGAGAGGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185097762 22:48821049-48821071 CTGCATGTGTGGAGCCAGGATGG - Intronic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
950406672 3:12809221-12809243 CAGCAGGTGTGTGGGGAGGAAGG + Intronic
950534220 3:13570025-13570047 ATGCAGGTGAGGATGGAGGATGG + Intronic
950554513 3:13687146-13687168 CTCCTTGTGTGGAGGGAGGACGG + Intergenic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950801508 3:15555351-15555373 CTGCAAATATGGAGGGACGAGGG + Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
952037565 3:29221146-29221168 GGACAGGTGTAGAGGGAAGATGG - Intergenic
953507247 3:43498344-43498366 TTGCAGGGGTGGAGGGCAGTTGG - Intronic
954304197 3:49716948-49716970 CTGCAGGGGGGCAGGGAAGGGGG - Exonic
954445328 3:50543188-50543210 GGGCAGGGGTGGGGGGAAGAGGG + Intergenic
954928716 3:54261290-54261312 CACCAGATGTGGAGAGAAGACGG - Intronic
955417345 3:58704836-58704858 CTGGAGGTGTTCAGGCAAGAAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957195851 3:77066968-77066990 TTGCAGGGGTGGAGGGGGGAGGG - Intronic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
960639550 3:119812803-119812825 CTGCAGCTGCGGGGGGAGGATGG + Exonic
960985792 3:123279801-123279823 CTGCAGGTGGGAAAGAAAGATGG + Intergenic
961003221 3:123388061-123388083 GTTCAGGGGTGTAGGGAAGATGG + Intronic
961069781 3:123911944-123911966 CTCCAGGGGTGGTGGGAATAAGG + Intronic
961232862 3:125334847-125334869 CTGCTGGAGTGGAGTGAACAAGG - Intronic
961542741 3:127611129-127611151 CTGCAGGTGGTGAGGGTAGAAGG - Intronic
961569046 3:127785193-127785215 CAGCAGGTGTGTGGGGAAGGAGG - Intronic
961666757 3:128497600-128497622 GTGCGAGTGTGGAAGGAAGAGGG + Intergenic
962207091 3:133443791-133443813 CTGCAGGTGTGGGGAGGAGGTGG - Intronic
962421751 3:135235002-135235024 TTCCAGGTATGGAGAGAAGAGGG - Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
963358072 3:144235694-144235716 CTGTAGGTGTGCAGGGGACAGGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
965283624 3:166786680-166786702 ATGCATATGTGGGGGGAAGAGGG + Intergenic
965475028 3:169146588-169146610 CTGCGGGCGAGGAGGAAAGAAGG + Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
967180425 3:186898397-186898419 CTGCTGGGGTGTAAGGAAGATGG - Intergenic
967289834 3:187908629-187908651 CTGCAGGAGTGCAGAGAATATGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967882659 3:194312963-194312985 CTGCTGGTGGGAAGGGAAGGAGG - Intergenic
967925169 3:194640152-194640174 CTGCAGGAGGGGAGGCGAGACGG + Intergenic
968435811 4:588433-588455 CCGCACGCGTGGAGGGACGACGG - Intergenic
968643203 4:1725374-1725396 CTGGAGGGGTAGAGGGGAGACGG - Intronic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
969306491 4:6328892-6328914 ATACAGGTGTGGATGGATGATGG + Intronic
969321758 4:6417000-6417022 AGGCAGGTGTGGAGGGAGCAGGG - Intronic
969535608 4:7754746-7754768 GGGCAGGTGTGGAGGGTGGAAGG + Intergenic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
970976752 4:22050500-22050522 GTGGAGGGGTGGAGGGCAGAGGG + Intergenic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
974036400 4:56821788-56821810 CGGTAGGTGGCGAGGGAAGAGGG + Intergenic
974941720 4:68477516-68477538 CTGCATTTGTGTAGGGAACAGGG - Exonic
975034955 4:69668759-69668781 CTGCTGCTGTGGAGTGAGGAGGG - Intergenic
975325133 4:73050729-73050751 TTTCAGGTGTGGAGAGAGGAGGG + Intergenic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
977507225 4:97917143-97917165 TTCCAGGTATGAAGGGAAGATGG + Intronic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
977758991 4:100708081-100708103 GTGAAAGTGTGGAGGGAAGGAGG + Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978826873 4:113035188-113035210 CTGCAGGTGGGTTGGGAAGGGGG + Intronic
978924919 4:114231600-114231622 CAGCAGCTGTGGAGGGATGAAGG - Intergenic
981113412 4:140960818-140960840 GCGCAGGTGTGGGGGGAAGGTGG + Intronic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982972958 4:162014102-162014124 CTGCATCTGTGGAGGCAAGTGGG + Intronic
983199595 4:164846584-164846606 CTGCAGCTGTGGTGTGAAGTGGG - Intergenic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985864481 5:2503526-2503548 TTGCAGCTGTGAAGGGAAGAGGG + Intergenic
986741674 5:10710550-10710572 CTGGAAGTGTGGTGGGATGATGG + Intronic
988905160 5:35780464-35780486 CTTCAGCTGTGGAGGGACGGAGG + Intronic
989358579 5:40573203-40573225 CTGCTGATGTGGAGGAGAGAAGG - Intergenic
990210579 5:53479146-53479168 TTGCAGTTGTGGAGGGGGGAAGG + Intergenic
990416995 5:55596311-55596333 CTGCATGTGGGGAGGAAAGATGG + Intergenic
991593661 5:68280101-68280123 CAGAATGTGTTGAGGGAAGATGG + Intronic
992079883 5:73226181-73226203 CTAAAGGTGTGGGGGGATGAAGG - Intergenic
992176559 5:74154945-74154967 CTGTAGGTGGGGAGCAAAGAGGG + Intergenic
992303424 5:75408896-75408918 GGACAGGGGTGGAGGGAAGAGGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994093116 5:95825919-95825941 GAGCAGGTATGGAGGAAAGAGGG - Intergenic
994146698 5:96403042-96403064 GTGCATGTGTGGAGGCAGGAAGG + Intronic
995633887 5:114163132-114163154 CTTCAGGGGTGGAGCCAAGATGG - Intergenic
996253161 5:121363402-121363424 CTAGAGGTGTGGAGAGAGGAAGG + Intergenic
997599943 5:135132291-135132313 CTGCATGGGTGGTGGGAAGTGGG - Intronic
998354795 5:141526021-141526043 ATGCAGGTGAGGAGTGAAGACGG - Exonic
998391537 5:141790016-141790038 CTCCTGGTGTGAGGGGAAGATGG - Intergenic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999275927 5:150330211-150330233 TTGAAGGTGTGGGTGGAAGAAGG + Intronic
999311762 5:150555992-150556014 TTGCAGGTATGGGGGGTAGAAGG + Exonic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999366125 5:151024613-151024635 CAGCAGCTGGGGAGGGAGGAAGG + Intronic
999869315 5:155732598-155732620 CTACTGGTGTGGTGAGAAGAAGG - Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001093399 5:168758009-168758031 CTCCCGGTGTGGAAGGAAAATGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002454574 5:179338847-179338869 CACCAGGCGTGGAGGGAAGCCGG + Intronic
1002887454 6:1310168-1310190 CTGCAGCTGGGGAGGGGAGGAGG + Intergenic
1003282432 6:4705689-4705711 GTGCAGGGGTGCAGGGAGGATGG - Intergenic
1004461338 6:15839788-15839810 CTGCTGGTGGGGAGGCAAAATGG - Intergenic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1005986880 6:30881227-30881249 CTGGAGGTGTGTTGGGAGGAGGG + Intronic
1005991089 6:30902609-30902631 CTGCAGGAGTCCAGGCAAGATGG - Intergenic
1006517313 6:34552191-34552213 CTGGAGGAGGGTAGGGAAGAGGG - Intronic
1006783039 6:36645091-36645113 CGTCTGGTGTGGAGGAAAGAGGG - Intergenic
1006897612 6:37480934-37480956 CTGCTGCTGTGGGGGAAAGACGG - Exonic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007600353 6:43077125-43077147 CTGCGGGTGAGGGCGGAAGAAGG + Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009027359 6:58016039-58016061 CTTCAGGAGAGAAGGGAAGAAGG - Intergenic
1010709880 6:79161571-79161593 GCGCAGGTGTCGAGTGAAGAGGG - Intergenic
1011191294 6:84731076-84731098 ATCCAGGTGTGTTGGGAAGAGGG + Intronic
1011716406 6:90109655-90109677 AAGCAGGTTTGGAGGGAGGATGG - Intronic
1011723512 6:90184467-90184489 GTGAAGGGGTGGAGGGAGGAAGG - Intronic
1014520711 6:122439094-122439116 CTGCAGGTGTGGAGAGTGCAAGG + Intergenic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1015958265 6:138620946-138620968 CTGCAGCTGGGGAGGACAGATGG + Intronic
1016215226 6:141591758-141591780 ATGCAGATGGGGTGGGAAGAGGG - Intergenic
1016887191 6:148969662-148969684 CTCCAGGTCTGGAGGAAAAATGG - Intronic
1016888309 6:148980318-148980340 CAGCAGCCGTGGAGAGAAGATGG - Intronic
1017055812 6:150434721-150434743 ATGGAGGTGGGGAGGGAAGGGGG - Intergenic
1017548571 6:155479442-155479464 CTGCACTTGTGGAGGGAGGGAGG + Intergenic
1017796564 6:157850093-157850115 GGGCAGGTGTGGAGGGGCGAGGG + Intronic
1017873089 6:158502754-158502776 CTGCAGGTGTACAGGGCAGGTGG - Exonic
1017945175 6:159090761-159090783 CTGCAGCTGAGGCGGTAAGACGG - Intergenic
1018383855 6:163285177-163285199 TTGCAGGTGGGGTGGGGAGAGGG - Intronic
1018596614 6:165487860-165487882 CTGCAAGTGTGCAGGGAAAAGGG - Intronic
1018721266 6:166574310-166574332 CTGCTGGGGAGGAGGGAAGGAGG - Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019494907 7:1333325-1333347 GAGGAGGTGAGGAGGGAAGAGGG - Intergenic
1019615765 7:1959800-1959822 CTGCAGGTGAGGGAGGACGAGGG + Intronic
1019625320 7:2012946-2012968 CAGCAGCTGTTCAGGGAAGATGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020257199 7:6508925-6508947 AAGCAGGTGTGGAGGGAGGCGGG - Intronic
1021543598 7:21788563-21788585 CTGCTGGTGGGGAGAGAGGAAGG - Intronic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022283489 7:28933560-28933582 CTGCCGGGGAGGAGTGAAGAAGG + Intergenic
1022818469 7:33935711-33935733 CTGCAGGTGTGGGGTGCAGGTGG + Intronic
1023105445 7:36759432-36759454 TTGTAGCTGTGGAGGGAAAAGGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023911562 7:44560251-44560273 CTGCAGGTTCTGATGGAAGAGGG + Intergenic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1025267898 7:57481268-57481290 CAGCAGGTGTGCACGGAAGTGGG - Intergenic
1025869150 7:65414783-65414805 CTGAAGGGGTGGAGCCAAGATGG + Intergenic
1026601727 7:71783104-71783126 AATCAGGTGTGGAGGGAAGATGG + Exonic
1026849658 7:73717010-73717032 CTGCAGATGGGGAGTGAAGGGGG - Intronic
1026895234 7:74006592-74006614 CTGCAGGGGTCTAGGGGAGATGG - Intergenic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1029222606 7:99002384-99002406 ATGCTGGTGTGGGAGGAAGAGGG + Intronic
1029327539 7:99823103-99823125 CTGCAGCTGTGCAGGGTAGGGGG - Intergenic
1029531363 7:101127399-101127421 CTGCAGGAGAGCAGGGAGGATGG + Intronic
1030310132 7:108060410-108060432 CTGCAGGTGTGGGGAGTGGAGGG + Intronic
1031910904 7:127515865-127515887 AGGCAGGTGTGGAGGGGAAAGGG - Intergenic
1033036323 7:137879330-137879352 GTGGAAGTGTGGAGGGAGGAGGG + Exonic
1033157011 7:138965896-138965918 ACTCAGGTGTGGAGGGAAGTGGG - Intronic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034564168 7:151900061-151900083 CTTCTGGAGTGGAGGGAAGGAGG - Intergenic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034958908 7:155352134-155352156 CTGCTGGTGTGCAGGGGACACGG + Intergenic
1035185831 7:157125373-157125395 ATGCAAGTGTGGAGGGAGGGAGG - Intergenic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1035778690 8:2209695-2209717 CTGCAGGTGCTGAGGACAGAGGG + Intergenic
1036244769 8:7106964-7106986 CTGCAGGTGTGTGGGCAAGGCGG - Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036777196 8:11621560-11621582 CTGCAGCTGGAGATGGAAGATGG - Intergenic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1039062892 8:33585776-33585798 CTGGAGGTGATAAGGGAAGAAGG + Intergenic
1039096005 8:33886136-33886158 CTACAGGGAGGGAGGGAAGAGGG + Intergenic
1039924346 8:41915736-41915758 TTGCAGGTTTGGGGGGAAGATGG - Intergenic
1040580930 8:48697980-48698002 GTGCAGGTGAAGATGGAAGACGG - Intergenic
1041009625 8:53529269-53529291 CTGCAGGTGGGGAGGGGAGGAGG + Intergenic
1041102663 8:54412308-54412330 CTGCAGGTGAGGAGGAAGCATGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1043635051 8:82375011-82375033 AAGCAGGTGTGGAGGGAGGAAGG + Intergenic
1044194383 8:89356816-89356838 CTGCAGGTGTTTAGGGAAAGTGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044771582 8:95641194-95641216 CCACAGCTGTGGAGGGCAGAGGG - Intergenic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045260782 8:100571552-100571574 CTGCAGGTGCTGGGAGAAGATGG - Intergenic
1045268852 8:100644581-100644603 CTGCAGGTGAGGATGACAGAGGG + Intronic
1045866210 8:106868493-106868515 CTGCATGTGTGCAGGGAGAAGGG - Intergenic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047535941 8:125719650-125719672 CAGAAGGTGTGGAATGAAGAAGG - Intergenic
1047906032 8:129474159-129474181 CTGCAGGTGTGGGGGGCAGCAGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049082843 8:140456919-140456941 CTGCAGGGGTGGAGGGGATTGGG + Intronic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049269460 8:141686533-141686555 CTCCACGTCTGGAGGGGAGACGG + Intergenic
1049284224 8:141765946-141765968 CTGGACGTGTGGATGGGAGAGGG + Intergenic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049545881 8:143230290-143230312 CTGCAGGTGGGAGGGGAAGGGGG + Intergenic
1050062080 9:1719854-1719876 CTGGAGGTGGGGAGTGAAGGAGG + Intergenic
1051086002 9:13349748-13349770 CTGCATGTGTGGGGGGGACAGGG - Intergenic
1052077548 9:24161638-24161660 CTCCACGTGTGAAGGGAGGAAGG - Intergenic
1052739591 9:32380762-32380784 TAGCAGGTGTGGTGAGAAGAGGG + Intergenic
1052739778 9:32382333-32382355 TAGCAGGTGTGGTGGGAAGAGGG + Intergenic
1053052684 9:34975028-34975050 CTGGAGGTGTGGAGAGCAGTTGG - Intronic
1053314601 9:37040929-37040951 CAGCTGGCGTGGAGGGGAGAGGG + Intergenic
1053405314 9:37870138-37870160 CTGCTGGTTTTGAAGGAAGAAGG - Intronic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1055828940 9:80358320-80358342 CTGCAGGTGGGGAGGTAGCAGGG + Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057054080 9:91948717-91948739 CTGCAGGAGTGCAGGGATGGGGG + Intronic
1057062429 9:92017569-92017591 CAGCAGGTGTGAAGGAAAAATGG + Intergenic
1057124786 9:92608583-92608605 GTACAGGTGGGGAGAGAAGATGG - Intronic
1057164911 9:92917770-92917792 CTGCAGGAGGGAAGGGAATAAGG - Intergenic
1057702991 9:97376986-97377008 GAGCAGGGGTGGAGGGATGAAGG - Intronic
1058349190 9:104000572-104000594 GTTCAGGGGAGGAGGGAAGAGGG + Intergenic
1058381733 9:104384300-104384322 CTGCAGGTGTGGTTGGAGGGAGG - Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058866713 9:109167409-109167431 CTGCCTGCGTGGAGGGAAGTCGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059339241 9:113588115-113588137 CTGCAGGGGAGGAAGGAAGCAGG - Intronic
1060939684 9:127536221-127536243 CCCCAGGTGTGGAGGCCAGAGGG + Intronic
1061187180 9:129061349-129061371 GAGCAGGTGTGGAGGGAGGGAGG + Intronic
1061256463 9:129456434-129456456 GTGGAGGTGAGGCGGGAAGAAGG + Intergenic
1061328758 9:129879509-129879531 CTGCTGCTGTGGAGGGTGGAGGG + Intronic
1061396142 9:130344147-130344169 CTGCAGGTCGGGAGGGGTGATGG - Intronic
1061589073 9:131587099-131587121 CTGCAGGTGTGTGTGTAAGACGG - Intronic
1061717534 9:132529892-132529914 CTGCTGGTGAGGATGGAAAATGG - Intronic
1061876384 9:133546227-133546249 CTGCAGGGGTGGTGGGGAGTGGG + Intronic
1062054292 9:134462983-134463005 CTGCTGGTGTGGTGGGATGGGGG + Intergenic
1062078090 9:134603051-134603073 CTGCTGGTGTGGTGCGAGGATGG + Intergenic
1062086957 9:134653942-134653964 CTGGAGGTGTGTAGGGCTGAGGG + Intronic
1062181834 9:135195136-135195158 CTGCAGGTCTGGGGGGTACATGG - Intergenic
1062327732 9:136020221-136020243 ATGCAGGTCTGGAGGGAAACCGG + Intronic
1062352118 9:136144316-136144338 CTGCAGGTCTGGAGAGAGGCTGG + Intergenic
1062643193 9:137532713-137532735 ATGCAGGTGAGACGGGAAGAGGG + Intronic
1062715864 9:138009811-138009833 CTGGAGGTGAGGATGGAACAGGG + Intronic
1187172938 X:16869793-16869815 CTGGAGGAGGGAAGGGAAGAGGG + Exonic
1188807986 X:34614875-34614897 CTCCAGGTGTTGAGGGAGGGTGG - Intergenic
1190322724 X:49188051-49188073 GTGGAGGTGTGGAGGGAGGGAGG + Exonic
1190823058 X:53992719-53992741 CGGCAGGTGAGGTGGGAAGGAGG - Exonic
1191911925 X:66160680-66160702 GTGGAGGGGTGCAGGGAAGAGGG - Intergenic
1192248243 X:69390532-69390554 CTGCAGGTGTACAGGGCAAAGGG - Intergenic
1192635074 X:72808250-72808272 CTGTAGGGGGGGAGGGACGATGG - Intronic
1192646641 X:72912553-72912575 CTGTAGGGGGGGAGGGACGATGG + Intronic
1192734889 X:73841257-73841279 TTGCAGATGAGGTGGGAAGAAGG + Intergenic
1193815163 X:86096154-86096176 ATGCACGTCTGGAGGGATGATGG - Intergenic
1194128446 X:90049113-90049135 ATGTAGGTGTAGATGGAAGAGGG - Intergenic
1194466568 X:94240995-94241017 CTGGAGGAGTTGAGGCAAGATGG - Intergenic
1194852678 X:98888758-98888780 CTGCATGTGTGGCATGAAGAGGG - Intergenic
1195378443 X:104249836-104249858 GGGGAGGTGTGGAGGGAAAATGG + Intergenic
1195997863 X:110749373-110749395 CTGCAGGAGGGGGAGGAAGAGGG - Intronic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196755191 X:119151251-119151273 ATGCTGTTGTGGCGGGAAGATGG - Intergenic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1197441766 X:126500201-126500223 TTGCTGGTGTGAAGGGAAAATGG - Intergenic
1199512858 X:148642166-148642188 CTGCAGGAGTGCATGGTAGAAGG + Intronic
1199871474 X:151902292-151902314 CTGCAGGGGTGGAGAGAGGCTGG + Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200124083 X:153805080-153805102 CAGCAGGTGAGGAAGGAAAAGGG - Exonic
1201470960 Y:14334529-14334551 CTGTAGGTGTGGGGAAAAGAAGG - Intergenic