ID: 1034461197

View in Genome Browser
Species Human (GRCh38)
Location 7:151198967-151198989
Sequence TGATGCTCAGGTGCTCTACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034461194_1034461197 1 Left 1034461194 7:151198943-151198965 CCTCCACGAGGCATGGCTGGGAG 0: 1
1: 0
2: 4
3: 24
4: 211
Right 1034461197 7:151198967-151198989 TGATGCTCAGGTGCTCTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 140
1034461190_1034461197 12 Left 1034461190 7:151198932-151198954 CCTCTGGACATCCTCCACGAGGC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1034461197 7:151198967-151198989 TGATGCTCAGGTGCTCTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 140
1034461195_1034461197 -2 Left 1034461195 7:151198946-151198968 CCACGAGGCATGGCTGGGAGATG 0: 1
1: 0
2: 1
3: 24
4: 182
Right 1034461197 7:151198967-151198989 TGATGCTCAGGTGCTCTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 140
1034461188_1034461197 25 Left 1034461188 7:151198919-151198941 CCATCTGGCGGAGCCTCTGGACA 0: 1
1: 0
2: 2
3: 26
4: 120
Right 1034461197 7:151198967-151198989 TGATGCTCAGGTGCTCTACCTGG 0: 1
1: 0
2: 1
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034461197 Original CRISPR TGATGCTCAGGTGCTCTACC TGG Exonic
903172214 1:21561258-21561280 TCATGTTCAGATGCTCGACCTGG - Intronic
905010818 1:34745961-34745983 TGAAGCTCAGCTTCTCTTCCTGG - Intronic
906689806 1:47785051-47785073 TGATCCTGCTGTGCTCTACCAGG - Intronic
907307783 1:53523145-53523167 TGAGGCTCAGGCACTGTACCTGG - Intronic
909552859 1:76918648-76918670 TGGTGCTCAGGTGCTCATCTTGG - Intronic
910033506 1:82761460-82761482 TGATGCTCAGGTAGTTAACCTGG - Intergenic
911748912 1:101472883-101472905 AGTTGCTGAGGTGCTGTACCAGG - Intergenic
912921109 1:113868257-113868279 GGATGCTCAGGGAATCTACCTGG + Intronic
917491739 1:175504048-175504070 TGATGCCCAGGAGCTCTTCGAGG + Intronic
1062805905 10:419283-419305 TGAAGCACAGGTGCTCACCCTGG + Intronic
1071886288 10:89954005-89954027 TGCTGCTCAGGTGCTTTTCCTGG + Intergenic
1072250196 10:93575847-93575869 TGAGGCTCAGTTGCTGTCCCTGG + Intronic
1072985368 10:100134866-100134888 TGAGGCTCAGGTGAGCTTCCTGG + Intergenic
1073658785 10:105448968-105448990 GGATGATCAGGTGCAATACCCGG + Intergenic
1075299711 10:121311061-121311083 TGATACTCAGGAGTTCTACTGGG - Intergenic
1075303099 10:121342884-121342906 TCATGTTCAGGTGCACTAGCTGG + Intergenic
1075711439 10:124532887-124532909 GGATGTTCAGGTGCTCGACTGGG + Intronic
1085318005 11:75557664-75557686 TGATGCCCAGGTGGGCTACAGGG - Intergenic
1089147003 11:116336427-116336449 TGATGCTCTGGGGCTCTACCTGG - Intergenic
1089387013 11:118075034-118075056 TGGTGCTCAGGTGATGAACCAGG - Intergenic
1090627623 11:128619954-128619976 TGATCTTCAGCTGCTCTAACAGG - Intergenic
1092281822 12:7103209-7103231 TGGTGCTCAACTGCTCTACTTGG + Intronic
1095345004 12:41139717-41139739 TGAGGCTCAAGTGATCTGCCTGG + Intergenic
1096808824 12:54156938-54156960 TGAAGCTCAGGCCCTCTAGCCGG - Intergenic
1099489556 12:83271431-83271453 GAATACTCAGTTGCTCTACCAGG + Intergenic
1101359313 12:104011061-104011083 TAGTGCTCAGTTTCTCTACCTGG - Intronic
1101852439 12:108414725-108414747 TGGTTCTCAGGTGCTTCACCGGG - Intergenic
1110507701 13:76307591-76307613 TAATGCTGATGTGTTCTACCAGG + Intergenic
1111521777 13:89413918-89413940 GGGTGCTCAGGTGATCTACTAGG + Intergenic
1113908079 13:113829507-113829529 TGAGGATCAGGTGGTCTCCCCGG - Intronic
1117292418 14:54346414-54346436 TGTTGCTCAGCTGCTATACTAGG + Intergenic
1117947485 14:61044055-61044077 TGATGCTCAGGGGCTCTTACAGG - Intronic
1120301444 14:82712479-82712501 TGATGCCCAGGTACTACACCAGG + Intergenic
1122290106 14:100676165-100676187 TGAGGCTCAGGTGGTGTCCCTGG + Intergenic
1125282863 15:38061498-38061520 TGATGCTGAGGTTCGGTACCTGG - Intergenic
1125911026 15:43439307-43439329 TGAAGCTCAAGTGATCCACCTGG - Intronic
1126063179 15:44803827-44803849 TGATGCTCTATTGCTCTTCCAGG + Intergenic
1132001031 15:98180291-98180313 TGATGCTCATGGGCTCTTCCAGG - Intergenic
1133113662 16:3564186-3564208 TGGTGATCAGGTGGTCCACCGGG + Exonic
1135803955 16:25525162-25525184 TGATGCTCTGGTGAACTGCCTGG + Intergenic
1137295857 16:47092732-47092754 ACATGCTCAGGTTCTCTCCCTGG + Intronic
1138424150 16:56919411-56919433 TGGTGCTCAGGGGCCCTGCCGGG - Intergenic
1141631380 16:85289878-85289900 ACATGCTCAGAAGCTCTACCAGG - Intergenic
1142342363 16:89532008-89532030 GGAGGCTCAGGTGCCCTTCCTGG + Exonic
1143415854 17:6749445-6749467 TAAAGCTCAGGTGAGCTACCTGG + Intergenic
1143473104 17:7188444-7188466 TGATTCTCAGGTGCTCCAGTGGG - Intergenic
1143713894 17:8753509-8753531 TGCTGCTCAGGGGCCCCACCAGG + Intronic
1144642907 17:16948417-16948439 TGCTGCTCAGGTGCTCACACAGG + Intronic
1144652942 17:17018584-17018606 CGATGCACAGGGGCTCTGCCTGG - Intergenic
1146532739 17:33623793-33623815 TGAGCCTCAGTTTCTCTACCTGG - Intronic
1147657406 17:42098594-42098616 TGTGGCTCAGATGCTCTCCCGGG - Intergenic
1150263837 17:63818913-63818935 TGATGCTCAGGTCCCCAGCCAGG + Exonic
1153935668 18:9918924-9918946 TCTTGCTCAGTTGCTCAACCTGG + Intronic
1155422431 18:25669547-25669569 TGAGGGTGAGGTGCTCTCCCAGG - Intergenic
1156799438 18:41091018-41091040 TGATGCTCAGGTTTTCTCCAGGG - Intergenic
1163055855 19:14717096-14717118 TGATGCTCACCTGATCTGCCTGG - Intronic
1164788528 19:30956919-30956941 TGCTCCTCAGGTGCCCAACCAGG + Intergenic
1165484066 19:36084701-36084723 TGATGCTGAGGTGCTGTGCCTGG + Exonic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168474226 19:56664469-56664491 GGATGCGCTGGTGCTCTATCAGG + Exonic
925847067 2:8043946-8043968 TGAGGCTCAGGGGATCTTCCTGG + Intergenic
928361626 2:30666634-30666656 TGAAGCTCAGCTGCTCTAACTGG - Intergenic
929805762 2:45143601-45143623 TGATGCTCAGGTTGTCTTGCAGG + Intergenic
934553213 2:95274687-95274709 TGAATGTCAGGTGCTCTGCCGGG - Exonic
935134399 2:100286915-100286937 TGAGGCTCAGGTTCTCTGTCTGG + Exonic
935705572 2:105853955-105853977 TCCTGCTAAGGTGCTCTAGCTGG - Intronic
935742176 2:106159382-106159404 TGATGCTCAGTCGTTTTACCAGG - Intronic
935771741 2:106430612-106430634 TGATGTTCAAATGCTCCACCAGG + Intronic
935908332 2:107865329-107865351 TGATGTTCAAATGCTCCACCAGG - Intronic
935994737 2:108757558-108757580 TGATGTTCAAATGCTCCACCAGG - Intronic
936130115 2:109830455-109830477 TGATGTTCAAATGCTCCACCAGG - Intronic
936214582 2:110541030-110541052 TGATGTTCAAATGCTCCACCAGG + Intronic
936423718 2:112395593-112395615 TGATGTTCAAATGCTCCACCAGG + Intronic
936957521 2:118037896-118037918 TGTTGTTCAGGTGATATACCTGG - Intergenic
938973707 2:136456061-136456083 TGATGCTCTGGCCCTCTGCCTGG + Intergenic
946004549 2:216512265-216512287 CCATGCTCAGGTATTCTACCAGG - Intronic
946946759 2:224829579-224829601 TGGAACTCAGGTGATCTACCTGG + Intronic
947784913 2:232808374-232808396 TGAGGCTCAGCTCCTCTAACCGG - Intronic
947960183 2:234229873-234229895 TGATGCTCAGGTTCTGCGCCTGG + Intergenic
948738919 2:240030294-240030316 TGATGGCCAGGTTCTCCACCAGG + Exonic
948740993 2:240045937-240045959 TGATGGCCAGGTTCTCCACCAGG + Exonic
949031004 2:241797541-241797563 TGCTGCTCAGGAACTCTTCCTGG + Intronic
1170693608 20:18637399-18637421 TGATGATCAGCCGCTCTACTGGG + Intronic
1171311918 20:24151450-24151472 TGCAGCCCAGGTGCTTTACCTGG - Intergenic
1172579302 20:36034222-36034244 TCATCCTCAGTTGCTCTTCCAGG - Intergenic
1174503830 20:51004248-51004270 TGCTGCTCAGGGCCACTACCTGG + Exonic
1175462736 20:59165266-59165288 TGATGTTCATGGTCTCTACCAGG - Intergenic
1180948009 22:19707508-19707530 TGATGCACAGGGGCTCGGCCTGG - Intergenic
1183293820 22:37018708-37018730 GGTTCATCAGGTGCTCTACCGGG - Exonic
950364424 3:12473023-12473045 TGAGGCTCAGGTGCTCTTGTTGG - Intergenic
950648612 3:14393258-14393280 TGAGTCTCAGGTGCTTGACCTGG - Intergenic
951984543 3:28603708-28603730 TTATGTACAGGAGCTCTACCAGG + Intergenic
952341235 3:32449381-32449403 TGATGCCCAGTTGCTCTTCCCGG + Intronic
952370187 3:32715093-32715115 AGATGCTTATGTGCTCTGCCCGG + Intronic
955082120 3:55667561-55667583 TGATTCTCAGCTGCACTAGCTGG - Intronic
959566381 3:107836549-107836571 TGATGCTCACCTGCTCTGACTGG - Intergenic
966736053 3:183188040-183188062 TGATGCTCAGGTGATCCACTAGG + Intronic
975703448 4:77088881-77088903 TGAGGCTCAAGAGCTCTAGCTGG + Intergenic
977882039 4:102216306-102216328 AGATGCTCAGGTGCTGTACACGG - Intergenic
979433377 4:120659705-120659727 TGATCCTCATGTGCTCTCACTGG + Intergenic
982233578 4:153231642-153231664 TGATGCTTAGGTGCTCTAAAGGG + Intronic
983632881 4:169867335-169867357 TGATGGTGAGGGGCTCTTCCGGG + Intergenic
984840728 4:184065096-184065118 TCATGCTCAGGTGCTGTAACAGG - Intergenic
985369088 4:189266109-189266131 TGCTTCTCAGGTGCTATTCCAGG - Intergenic
989109735 5:37895942-37895964 TGAAGCTAGGGTTCTCTACCTGG + Intergenic
989857578 5:46317259-46317281 TAATGCCTAGGTTCTCTACCAGG - Intergenic
999055085 5:148565768-148565790 TGAAGTTCAGATTCTCTACCTGG + Intronic
999692277 5:154158405-154158427 TGAATCTCAGGTTCTCTACCTGG - Intronic
1003739167 6:8915171-8915193 TGCTTCTCAGGTGCTGTCCCAGG + Intergenic
1006189207 6:32197298-32197320 TGATGCTCGGGAGGTCTGCCAGG - Exonic
1008960308 6:57259655-57259677 GGATGCTGAGGTGCACTTCCTGG + Intergenic
1016462681 6:144294564-144294586 TGATCCTCATCTGCTCTTCCAGG + Intronic
1019540266 7:1548124-1548146 AGGTGCTCAGGAGCTCTCCCGGG + Intronic
1022420376 7:30215218-30215240 TTATGCCCTGGAGCTCTACCAGG + Intergenic
1023825668 7:44007226-44007248 TGCTGCTCAGGGGCACCACCAGG - Intronic
1024205274 7:47153952-47153974 AGAGGCTCAGGTGCTCGAGCTGG - Intergenic
1024522501 7:50318195-50318217 TGATGCTGGGGTTCTCTCCCTGG + Intronic
1026089222 7:67286002-67286024 TGCTGCTCAGGGGCACCACCAGG - Intergenic
1026747164 7:73022544-73022566 TGCTGCTCAGGGGCACCACCAGG + Intergenic
1026750814 7:73050687-73050709 TGCTGCTCAGGGGCACCACCAGG + Intergenic
1026754463 7:73078797-73078819 TGCTGCTCAGGGGCACCACCAGG + Intergenic
1026758115 7:73106830-73106852 TGCTGCTCAGGGGCACCACCAGG + Intergenic
1027033268 7:74907115-74907137 TGCTGCTCAGGGGCACCACCAGG + Intergenic
1027089290 7:75286654-75286676 TGCTGCTCAGGGGCACCACCAGG - Intergenic
1027092933 7:75314582-75314604 TGCTGCTCAGGGGCACCACCAGG - Intergenic
1027096576 7:75342549-75342571 TGCTGCTCAGGGGCACCACCAGG - Intergenic
1027272984 7:76534139-76534161 TGCTGCTCAGGGGCACCACCAGG + Intergenic
1027322771 7:77025131-77025153 TGCTGCTCAGGGGCACCACCAGG + Intergenic
1027326434 7:77053223-77053245 TGGTGCTCAGGGGCACCACCAGG + Intergenic
1029397687 7:100319523-100319545 TGCTGCTCAGGGGCACCACCAGG - Intronic
1029705435 7:102273442-102273464 TGATGCTCAGGTCCTGCTCCAGG - Intronic
1029718675 7:102348697-102348719 TGCTGCTCAGGGGCACCACCAGG + Intergenic
1029753940 7:102560558-102560580 TGCTGCTCAGGGGCACCACCAGG - Intronic
1029771890 7:102659648-102659670 TGCTGCTCAGGGGCACCACCAGG - Intronic
1031012958 7:116542776-116542798 TGATACTCTGGTGTTCTAACTGG - Intronic
1032324218 7:130911669-130911691 TGATGCTTTGGTTCTCAACCAGG - Intergenic
1033686663 7:143646784-143646806 TGAGGCTGCGGTGCTCTCCCTGG - Intronic
1033689071 7:143720523-143720545 TGAGGCTGCGGTGCTCTCCCTGG + Exonic
1033697946 7:143810830-143810852 TGAGGCTGCGGTGCTCTCCCTGG + Intergenic
1034461197 7:151198967-151198989 TGATGCTCAGGTGCTCTACCTGG + Exonic
1036018852 8:4819053-4819075 TGTTGCTGAGCTGCTCTTCCAGG - Intronic
1044982487 8:97730853-97730875 TGTTGCTCAGGTGCTCAGGCTGG + Intergenic
1048957831 8:139551381-139551403 TGTTTCTCAGGTGATCTACCTGG + Intergenic
1050144372 9:2550325-2550347 TGAAGACCAAGTGCTCTACCTGG + Intergenic
1051955753 9:22691337-22691359 TGACACTCAGGTGGTCTACTTGG - Intergenic
1056535490 9:87524165-87524187 TGATGCTCTGGGCCTCTCCCTGG + Intronic
1057638726 9:96796532-96796554 AGCTGCTGAGGTGCTCCACCTGG + Intergenic
1062280497 9:135749627-135749649 TGATGGTCAGCTGCTCTGTCTGG - Intronic
1194380215 X:93181553-93181575 AGATGCCCAGGTCCTGTACCTGG - Intergenic
1199791176 X:151156681-151156703 TGCTGCTGAGGAGCACTACCCGG + Intergenic
1199980610 X:152918493-152918515 CGAGCCTCAGGTGCTCTGCCTGG + Intronic
1200337293 X:155363678-155363700 GGCTTCTCAGGTGCTCAACCAGG - Intergenic
1200349177 X:155477549-155477571 GGCTTCTCAGGTGCTCAACCAGG + Intergenic
1201516736 Y:14825974-14825996 TGAGCCTCAGGTGCTCTGGCAGG - Intronic