ID: 1034463440

View in Genome Browser
Species Human (GRCh38)
Location 7:151211240-151211262
Sequence ATGCTGTGATTAAAGAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034463436_1034463440 9 Left 1034463436 7:151211208-151211230 CCTATGGGGGAACAAATACTTCA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1034463440 7:151211240-151211262 ATGCTGTGATTAAAGAAACCTGG 0: 1
1: 0
2: 2
3: 21
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034463440 Original CRISPR ATGCTGTGATTAAAGAAACC TGG Intronic
905598276 1:39228043-39228065 ATGCTGGGATTACAGGCACCTGG - Intronic
905994606 1:42370595-42370617 ACACTGAGATGAAAGAAACCTGG + Intergenic
907123086 1:52024784-52024806 TTGCTGTCATTAAACAAGCCAGG + Intronic
911592180 1:99761066-99761088 GTGCTGTGATTAGAGAAACTAGG - Intronic
912260234 1:108103893-108103915 AAGCTGTCATTATAGCAACCTGG + Intergenic
915936983 1:160095402-160095424 ATGCTGTGATATAAGACACCTGG + Intronic
916210284 1:162354731-162354753 ATTCTGTAGTTAAAGAAACATGG + Intronic
918654982 1:187013825-187013847 ATCATGTGATTAAAAAAAACTGG - Intergenic
919088051 1:192945107-192945129 ATGGTGTCATTTAAGAACCCTGG - Intergenic
921317956 1:213909703-213909725 AAGCTGTTATGAAGGAAACCTGG + Intergenic
921586922 1:216958051-216958073 ATGCTGTGGTAAAGGAAGCCAGG - Intronic
921722596 1:218490135-218490157 ATGCTCTCATTAAAGTTACCAGG + Intergenic
923310739 1:232732364-232732386 TTGAAGAGATTAAAGAAACCAGG + Intergenic
923487620 1:234449704-234449726 ATGGTCAGATTAAAGAAATCAGG + Intronic
924140877 1:241021982-241022004 ATGCAGTGATCAGAGAACCCAGG - Intronic
1064824279 10:19377984-19378006 ATTCTGTGATTAAAGTAAGCTGG + Intronic
1064943434 10:20760458-20760480 ATGCTTTGACCAAAGAAATCTGG - Intergenic
1066034338 10:31467129-31467151 AAGGTGTGAGTGAAGAAACCCGG + Intronic
1068811440 10:61259911-61259933 ATTCTGAGATTAAAAATACCTGG + Intergenic
1070354876 10:75630277-75630299 ATGGTGTGATTGCAGAAAGCAGG + Intronic
1070468860 10:76756950-76756972 ATTCTCTGATAAAAGAAACCAGG + Intergenic
1070654999 10:78265378-78265400 ATGGTGTGTTTAAAGGAGCCTGG - Intergenic
1070963774 10:80517006-80517028 ATTCAGTGATCAGAGAAACCAGG + Intronic
1071375701 10:85000521-85000543 ATTCTGTGATCAAATAAATCTGG + Intergenic
1075251004 10:120873326-120873348 TTTCTGCAATTAAAGAAACCTGG - Intronic
1075361919 10:121846014-121846036 ATTCTGCAATAAAAGAAACCAGG + Intronic
1075499587 10:122960695-122960717 TTGCTGTGATTAAGAAAATCTGG + Intronic
1076809200 10:132878069-132878091 CTGCTGTCATCAAAGAAACCTGG + Exonic
1076830455 10:132991836-132991858 CTGCCGTGATTAAAGAGACAAGG - Intergenic
1080201152 11:29671918-29671940 ATGCAGTGATTCAAGGATCCAGG + Intergenic
1081670422 11:44939257-44939279 CAGCTGTGATTAGAGAAGCCAGG - Intronic
1082922681 11:58512770-58512792 ATTCTCTAATAAAAGAAACCAGG + Intergenic
1089441363 11:118520272-118520294 ATACTATCATTAAAGAAAACAGG - Intronic
1091354536 11:134925860-134925882 ATTCTGCAATAAAAGAAACCAGG - Intergenic
1091398330 12:167998-168020 ATGGTGTGATTTAGGCAACCAGG + Intronic
1092826719 12:12407193-12407215 ATCCTGTGTTAAAAGAAACATGG + Intronic
1093414938 12:18909001-18909023 ATCCTGTTAATAAAGATACCTGG - Intergenic
1096850872 12:54435562-54435584 ATGCTGTGACTAGTGAAATCAGG - Intergenic
1097368049 12:58742008-58742030 ATGATGTGATAAAGAAAACCTGG + Intronic
1097629867 12:62047527-62047549 ACTCTGTGATCAAATAAACCTGG - Intronic
1098154648 12:67584992-67585014 ATGCTGTGATCCAAGAGACGAGG + Intergenic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1099479519 12:83148584-83148606 ATGCAGTGATTAAAAATGCCAGG + Intergenic
1099960184 12:89389540-89389562 ATGCTGTAATTGAAGCTACCTGG - Intergenic
1102097071 12:110249400-110249422 CTGCTGTGTCTAAAGAAACACGG - Intergenic
1102649338 12:114427034-114427056 ATGGTGAGATGAAGGAAACCAGG + Intergenic
1104262870 12:127200687-127200709 ATGATGGGATTAAAGGCACCAGG + Intergenic
1104292072 12:127479457-127479479 AGGATGTGATTAATGACACCAGG - Intergenic
1105035873 12:132920437-132920459 ATGCTAACATTAAATAAACCAGG - Intronic
1105053155 12:133073264-133073286 ATGCTATGATAAAACAAAACAGG + Intergenic
1105238727 13:18589786-18589808 ATGATATAATTAAAAAAACCAGG + Intergenic
1107326445 13:39248545-39248567 ATTCTGTAATAAAAGAAACCAGG + Intergenic
1107665263 13:42681872-42681894 ATGAGGTGTTTAATGAAACCAGG - Intergenic
1108216246 13:48187664-48187686 ATGGTGTGATTAAAGAATACTGG + Intergenic
1108596071 13:51950692-51950714 GTGCTGTGATGAAAAAAACAAGG + Intronic
1108967257 13:56324637-56324659 ATTCTGTGATGAAAGTAGCCTGG - Intergenic
1109826984 13:67734641-67734663 ATCCTGTGTTTAAATAAACAAGG - Intergenic
1110178026 13:72580767-72580789 ATACTGTGATAAAAGAACTCAGG + Intergenic
1110620591 13:77590693-77590715 TTGCTGTGATTAAAGTAGTCAGG - Intronic
1110968184 13:81727413-81727435 ACATTGTCATTAAAGAAACCTGG - Intergenic
1111877916 13:93919614-93919636 ATGCTTTGATTAATGAACCTGGG + Intronic
1114004877 14:18301587-18301609 TTGCTGTGAACAAGGAAACCTGG + Intergenic
1114637248 14:24195049-24195071 ATCCTGAGGTTATAGAAACCAGG + Intronic
1114739366 14:25079418-25079440 ATACTCTAATTAAAGAAAACAGG - Intergenic
1114977502 14:28120355-28120377 ATATTGTGATTAAACAAACAGGG - Intergenic
1115801930 14:37004439-37004461 ATGCTGTGTTTGAGGACACCTGG + Intronic
1119527979 14:75337631-75337653 ATTCTCTGATTAAAGGAACCAGG - Intergenic
1120432025 14:84431214-84431236 ATGCTGTGATTCACGAATCTTGG - Intergenic
1120867495 14:89308503-89308525 ATTCTGTGAATGAAGATACCTGG + Intronic
1121184366 14:91953717-91953739 AAGCTGTGAGTAGAGAAAGCAGG - Intergenic
1121897330 14:97660548-97660570 ATGCTGAGATTCAGGAATCCTGG + Intergenic
1123634324 15:22288566-22288588 AAGCTGGGATTAAAGAAATGCGG - Intergenic
1126842749 15:52733364-52733386 ATACTGTGATGCAAGAACCCTGG - Intergenic
1127075688 15:55323269-55323291 AGGCTGTGAGTAAATAGACCTGG - Intronic
1127162091 15:56199508-56199530 ATGCTTGCATTAAAGAAAACAGG - Intronic
1127431600 15:58915264-58915286 GTGTTATGATTAAATAAACCTGG - Intronic
1127852863 15:62929292-62929314 ATGCTGTGATGAGAGAAAGGTGG + Intergenic
1128113580 15:65091721-65091743 ATGTTCTGATTAAGGTAACCTGG - Intergenic
1129378973 15:75153791-75153813 AGGCTGTGGTTAAAGAGACTGGG + Intergenic
1130701924 15:86192502-86192524 AGGCTGTGATTAAACAGATCTGG + Intronic
1131501687 15:92973476-92973498 ATGTTGGGATTGAAGAAACTTGG + Intronic
1133635787 16:7663904-7663926 ATGCTTTGAGTAAAACAACCAGG - Intronic
1134781792 16:16904765-16904787 TTGCTGTGATGAAGGAAACCTGG + Intergenic
1137545792 16:49402325-49402347 ATGCAGTCATTAAGAAAACCTGG + Intergenic
1139675940 16:68523601-68523623 AGCCTGTGATAAAAGAGACCAGG + Intergenic
1140945498 16:79764655-79764677 GTGCTGTGATTACAGCATCCTGG - Intergenic
1144297464 17:13889700-13889722 ATGGTGGGATTAAAGACACTAGG + Intergenic
1146573605 17:33973402-33973424 AAGCTGTGCTTAAAGAGCCCTGG + Intronic
1151655875 17:75495745-75495767 ATGCAGGGAGTAAAGGAACCTGG + Intronic
1153314526 18:3708883-3708905 AATCTGTTTTTAAAGAAACCTGG - Intronic
1153823198 18:8850144-8850166 CTGCTGTGATGAGAGAAACTGGG + Intergenic
1154092261 18:11376615-11376637 ATGCTGGAATTGAAGAAAACTGG - Intergenic
1154481724 18:14833879-14833901 ATTCTGTGATTAAAAAAGTCTGG - Intronic
1155044886 18:22095037-22095059 ATTCTGTAATTAATAAAACCAGG + Intronic
1155710429 18:28870413-28870435 ATGCTGTGAACAAAGAAAAGAGG - Intergenic
1157036309 18:43979252-43979274 ATGCTGTGGTTAAAGCAATTGGG - Intergenic
1157316564 18:46594731-46594753 ATGATGTGCTTAAAGAAATACGG - Intronic
1158433429 18:57414451-57414473 ATGTTTTCATTAAAGAAAACTGG + Intergenic
1158659718 18:59375303-59375325 ATTCTGTGATTAAATAAACTAGG - Intergenic
1158738547 18:60112585-60112607 ATGCTGTGATTACAAAGACCAGG - Intergenic
1164149449 19:22537580-22537602 ATGCTATGATTAAATATATCAGG + Intergenic
928747227 2:34429518-34429540 CAGCTGTGATTAAACAAAACTGG + Intergenic
930328693 2:49954449-49954471 ATGCAGTGATAAAATAAATCAGG - Intronic
930654974 2:53998869-53998891 ATGCTGAGATTCACGAATCCAGG + Intronic
930682186 2:54268363-54268385 GTGTGGTGATTAAGGAAACCTGG + Intronic
931904519 2:66828083-66828105 AGACTGTGAGTAAAGAAGCCAGG - Intergenic
933455136 2:82510138-82510160 ATACTGTTATTAAATAAACCTGG - Intergenic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935829335 2:106984102-106984124 ATCCTGCGATAAAAGGAACCAGG - Intergenic
939940763 2:148348060-148348082 ATGCTGTGTTTAAAGAAATCAGG + Intronic
940047071 2:149421091-149421113 GTGCTGGGATTAAAGAAAGAGGG - Intronic
940076253 2:149745396-149745418 ATCCTGTGATAAAAGACAACTGG - Intergenic
940390864 2:153131133-153131155 ATGATGTGAAAAAAGACACCAGG + Intergenic
942684857 2:178520429-178520451 GTGCTATGATCAAAGAAATCTGG - Intergenic
943241327 2:185388075-185388097 ATGCTGTGGTGTATGAAACCTGG - Intergenic
945465214 2:210161330-210161352 ATGATATGATTTAAGAAACAAGG - Intronic
945834546 2:214823105-214823127 ATGATGTGATGAAAGAAAGGAGG + Intergenic
946625789 2:221611063-221611085 ATGCTGTGAGTATAGAAACCAGG + Intergenic
947165474 2:227257349-227257371 ATGGTGTTGTGAAAGAAACCTGG + Intronic
948559961 2:238846245-238846267 CTGCTCTGAGCAAAGAAACCAGG + Intergenic
948572054 2:238923871-238923893 ATGCTGTGTTTAATGCAATCTGG + Intergenic
1169975595 20:11323727-11323749 ATGCTGTGTCTAAAGGAACCTGG + Intergenic
1170839661 20:19914078-19914100 ATACTGTTATTAAAGCCACCTGG - Intronic
1171296800 20:24024133-24024155 ATGCAGTGATTGAAGAAATATGG + Intergenic
1175458074 20:59130172-59130194 TTGCTGTTATTAAAGAGACAGGG + Intergenic
1176056971 20:63154152-63154174 ATGCTTTGATTTAAAAATCCAGG - Intergenic
1178031059 21:28526692-28526714 ATGCAGTAATTCAGGAAACCTGG - Intergenic
1179163342 21:38915754-38915776 AAGCTGTGAGTGAAGAAGCCAGG - Intergenic
1179163884 21:38919987-38920009 AAGCTGGGATTACAGAAAGCGGG + Intergenic
1180429391 22:15232377-15232399 TTGCTGTGAACAAGGAAACCTGG + Intergenic
1182648341 22:31828991-31829013 GTGCTGTGATGAAAACAACCAGG + Intronic
1184743873 22:46444903-46444925 TTCCTGTTATTAAAGACACCAGG + Intronic
949429194 3:3955021-3955043 ATGATTTTATTCAAGAAACCAGG - Intronic
949662416 3:6294272-6294294 TGGCTTTGATTATAGAAACCTGG - Intergenic
949721695 3:6997852-6997874 GTGCTGGGATTACAGACACCTGG - Intronic
949868700 3:8568876-8568898 ATGGTGAGGTTAAAGAAAACTGG - Intergenic
950377475 3:12583742-12583764 ATGATGTGACTAGAGAAACAAGG + Exonic
950459042 3:13110288-13110310 ATTTTGTAGTTAAAGAAACCCGG + Intergenic
950929824 3:16777345-16777367 CTGCTGAGATTTAAGAATCCTGG + Intergenic
951295958 3:20934824-20934846 ATGCTGGTATTGAAGAAACGTGG + Intergenic
952277355 3:31890320-31890342 CTGCTGTGATTTAGGAAAGCTGG - Intronic
955745309 3:62134635-62134657 GTGCTTTGAAGAAAGAAACCTGG - Intronic
956329093 3:68085234-68085256 ATTCTGTGGTTAAAGAAATCTGG + Intronic
956603101 3:71044398-71044420 ATGAGATGATTAAAGAGACCAGG + Intronic
965016384 3:163163365-163163387 ATGCAGTCATTAGAGAAACATGG - Intergenic
966790890 3:183668510-183668532 ATACTCTGTTTAAGGAAACCTGG + Intronic
967768749 3:193311419-193311441 TTGCTGTAATTTAAGAATCCAGG + Intronic
970151008 4:13090023-13090045 CTGCTGTCATGAGAGAAACCAGG - Intergenic
970597949 4:17617027-17617049 CTGCTCTGATAGAAGAAACCTGG + Intronic
970787481 4:19816445-19816467 ATGCTGAGAATAAAGACAACTGG - Intergenic
971965018 4:33542652-33542674 ATGCCATGAAGAAAGAAACCAGG + Intergenic
974297031 4:60013439-60013461 ATGCTGTTAATTAGGAAACCAGG + Intergenic
975014999 4:69404395-69404417 TTGGTATGATTAAAAAAACCTGG - Intronic
978040245 4:104051530-104051552 ATTCTGTGAGTCAAGAATCCAGG - Intergenic
983316973 4:166144929-166144951 ATGCTGTGGTAGAAGGAACCAGG + Intergenic
984559785 4:181254785-181254807 ATGCTTTAAATAAAGGAACCAGG + Intergenic
984991429 4:185385129-185385151 ATTCTGTGATCAAATAAAACAGG + Intronic
985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG + Intergenic
986350627 5:6876038-6876060 ATTCTGCAATAAAAGAAACCAGG - Intergenic
988030925 5:25761623-25761645 ATACTGTGCTCATAGAAACCCGG + Intergenic
989394965 5:40944918-40944940 ATGCTGACATTAAAGGAACATGG + Intronic
990690464 5:58358183-58358205 ATGATATGATTGAAAAAACCGGG - Intergenic
990756548 5:59078240-59078262 ATGCTGCAATTTAAGAAAACTGG + Intronic
992181086 5:74199288-74199310 ATGCTGGGTTTACAGAAACCAGG - Intergenic
992472098 5:77068002-77068024 AAGCTGTGACTGAAGAAACATGG + Intergenic
994181711 5:96774626-96774648 ATGCCTTGATTAATGAAACATGG - Exonic
995201668 5:109431851-109431873 TTTCTGTTATTAAAGAAAGCAGG + Intergenic
995546573 5:113238272-113238294 TTGCTTTGATTAAAAAAAACAGG - Intronic
995900866 5:117064823-117064845 ATGGTGAGATTATAGAAAGCAGG - Intergenic
996550816 5:124728120-124728142 AAGGTGTGATTTAAGACACCAGG + Intronic
998178646 5:139919110-139919132 GTGCTGAGATTGCAGAAACCTGG - Intronic
998761547 5:145437810-145437832 ATGCTGCTATTAAAGAAATATGG + Intergenic
999769138 5:154761852-154761874 ATTCTGTGAATAAGGAAAACAGG - Intronic
1000832149 5:166116178-166116200 ATGCTGTCATTAAAAAAATGAGG - Intergenic
1002430769 5:179202716-179202738 ATGGTGTGAGTAAGGAAACACGG - Intronic
1003556977 6:7148656-7148678 ATGCTATGCTTAAGGAAACAGGG + Intronic
1005145122 6:22680725-22680747 ATGCTGTTATTAGAGAGACTGGG - Intergenic
1007487515 6:42191966-42191988 AAGCTGAGATTAAAGATTCCAGG + Intronic
1007922633 6:45624591-45624613 ATGCTGTGACTTCAGAAGCCTGG + Intronic
1009996517 6:70901344-70901366 ATTCTCTTATAAAAGAAACCAGG + Intronic
1013201259 6:107898346-107898368 ATACTGTGTTTTCAGAAACCTGG - Intronic
1016129207 6:140444903-140444925 GTGCTGTGATTAAATGCACCTGG - Intergenic
1016909301 6:149181484-149181506 ATGATGTAGTTAAAGAAATCAGG - Intergenic
1019188178 6:170233356-170233378 ATGGTGTTTTGAAAGAAACCAGG - Intergenic
1020856313 7:13429137-13429159 GTCCTGTGATCAAAGAAACTGGG + Intergenic
1021620208 7:22543775-22543797 ATGCTGTGAGTCAGGCAACCTGG + Intronic
1022053625 7:26705553-26705575 AAGCAGTGATTAAAGAATTCAGG + Intronic
1024971691 7:55077783-55077805 ATGCTCTTAAAAAAGAAACCTGG + Intronic
1026259162 7:68739192-68739214 ATGCAGTGATTAAAAAAAAGAGG - Intergenic
1026329691 7:69340930-69340952 ATGCTATGATGAAACAAAACAGG - Intergenic
1026377159 7:69763335-69763357 ATGCTGTGGGTAGAGAAGCCTGG + Intronic
1029446828 7:100618040-100618062 AAGCTGTGATTAAAGGCACACGG + Intergenic
1031411904 7:121449306-121449328 ATGCTCTGATTAACCAGACCAGG + Intergenic
1034014059 7:147563098-147563120 ATGTGGTGATTAATGAAGCCAGG - Intronic
1034463440 7:151211240-151211262 ATGCTGTGATTAAAGAAACCTGG + Intronic
1034530166 7:151690631-151690653 ATGCACTGATTCTAGAAACCTGG - Intronic
1034679708 7:152919333-152919355 GTGCTGGGATTACAGACACCCGG + Intergenic
1034960264 7:155360357-155360379 CTGCTGTGATTTAAGATGCCAGG - Intronic
1037476961 8:19267470-19267492 ATGCTGTGTTAACAGAAACTGGG - Intergenic
1038708455 8:29919404-29919426 GTACAGTGATCAAAGAAACCAGG + Intergenic
1039223735 8:35364518-35364540 ATTCTGTAATAAAAGCAACCAGG - Intronic
1039719753 8:40150641-40150663 ATTCTGTTATAAAATAAACCTGG - Intergenic
1040580779 8:48697042-48697064 CTGCTGTGATGAAGGATACCTGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041089687 8:54290550-54290572 ATTCTGTGATAAAAATAACCAGG - Intergenic
1041493151 8:58456594-58456616 CTGCTGTGATTCTAGAAATCTGG + Intergenic
1041555600 8:59151210-59151232 AAGCTGTTATCAAAAAAACCAGG - Intergenic
1041644393 8:60236835-60236857 ATGCAGTGGTTAAAGATATCTGG + Intronic
1041935939 8:63331741-63331763 ATTCAGTGAGTAAAGAAAGCAGG - Intergenic
1043507487 8:80916641-80916663 ATTCTGTGATTTAAGATACATGG - Intergenic
1044333323 8:90946604-90946626 ATGCTGTCATCAAAGATCCCAGG + Intronic
1044356522 8:91228749-91228771 CTGGTGTGACTGAAGAAACCAGG + Intronic
1044482953 8:92714122-92714144 ATGCCATGATTAAAGAAAAGGGG - Intergenic
1044906597 8:97010590-97010612 ATGCTGTGTTTAGAGACAGCTGG - Intronic
1045961706 8:107976293-107976315 ATGGTTTAATTAAAGAAACATGG + Intronic
1046441779 8:114265158-114265180 CTGTTGTGATTATAGAAACCTGG + Intergenic
1046711224 8:117513940-117513962 AGGCTGTAATTAAATAAACATGG - Intergenic
1047585318 8:126265749-126265771 ATCCTCTCATTAAAGAAATCAGG + Intergenic
1047920227 8:129628037-129628059 ATGCAGGGAATAAAGACACCAGG + Intergenic
1048578305 8:135710129-135710151 ATGCTGGGTTTAAAGCAAGCAGG - Intergenic
1048693581 8:136996566-136996588 ATGTTGTGATGGAAGAAACTGGG - Intergenic
1050599612 9:7237064-7237086 ATTCAGTGATTAAAGAAAATAGG + Intergenic
1053326186 9:37153788-37153810 ATTCTCCAATTAAAGAAACCAGG - Intronic
1055474825 9:76652191-76652213 ATGCTGTGTTACAAGAAACCTGG - Intronic
1056109227 9:83378069-83378091 ATGCTGTAAGTGAGGAAACCAGG - Intronic
1056242096 9:84657903-84657925 AAGCTGATATTAAAGAAACAAGG + Intergenic
1057616513 9:96595680-96595702 ATGCTGTATGAAAAGAAACCAGG + Intronic
1057845857 9:98522033-98522055 AAACTGAGATAAAAGAAACCAGG + Intronic
1059469971 9:114497472-114497494 ATGCTGGGTTTCTAGAAACCTGG + Intronic
1061864093 9:133483612-133483634 AAGCTTTGATTAAATAAATCTGG - Intergenic
1062276745 9:135734944-135734966 GTGCTGTGAGTAAACAGACCAGG - Intronic
1186456865 X:9716610-9716632 ATGCTGTGATAAACCAAACAGGG + Exonic
1186683572 X:11900803-11900825 ATGCTGTGATTGGAGAAAGGGGG + Intergenic
1187049917 X:15685684-15685706 ATGCTGTGATTAAAAATTCAAGG + Intergenic
1187690931 X:21865602-21865624 ATGTTGTGATTATAGTAAGCTGG + Intronic
1189646551 X:43138855-43138877 AGGAGGTGATTAAAGAAATCTGG + Intergenic
1191963262 X:66726905-66726927 ATCCTGTGAATGGAGAAACCCGG - Intergenic
1193686653 X:84584782-84584804 TTACTGTGATTAATGAAAACAGG + Intergenic
1193773928 X:85620430-85620452 GAGGTGTGAATAAAGAAACCAGG - Intergenic
1194025721 X:88747548-88747570 ATGTTGTGACAAATGAAACCAGG - Intronic
1194294496 X:92111575-92111597 ATGTTGTGACTAAAGGAAACTGG - Intronic
1194943672 X:100042844-100042866 ATTCTGTAATCAAAGAAACAGGG - Intergenic
1196406305 X:115366160-115366182 AAACTGGGATTCAAGAAACCTGG + Intergenic
1197904705 X:131412534-131412556 ATGCTGTCCTTAAAGACAGCTGG - Intergenic
1197905080 X:131415929-131415951 ATGCTGTCCTTAAAGACATCTGG - Intergenic
1198804482 X:140480751-140480773 ATGCTGTGATTGGAGAAAGGGGG - Intergenic
1199150841 X:144484913-144484935 ATTCTGTGATGAAATAAAGCAGG + Intergenic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1200612002 Y:5336085-5336107 ATGCTGTGACTAAAGGAAACTGG - Intronic
1200690424 Y:6303309-6303331 ATCCTGTGATATAAGAAACCTGG - Intergenic
1201044849 Y:9871407-9871429 ATCCTGTGATATAAGAAACCTGG + Intergenic
1201060967 Y:10046500-10046522 ATCCTGTGATATAAGAAACCTGG - Intergenic
1202305709 Y:23468230-23468252 ACGCTGGGATTAAAGAAATGCGG - Intergenic
1202565100 Y:26202359-26202381 ACGCTGGGATTAAAGAAATGCGG + Intergenic