ID: 1034466423

View in Genome Browser
Species Human (GRCh38)
Location 7:151232626-151232648
Sequence CCCGGGAGGGGGCGGGGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2473
Summary {0: 1, 1: 1, 2: 31, 3: 325, 4: 2115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466423_1034466436 -6 Left 1034466423 7:151232626-151232648 CCTCCGCCCCGCCCCCTCCCGGG 0: 1
1: 1
2: 31
3: 325
4: 2115
Right 1034466436 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 20
4: 318
1034466423_1034466439 9 Left 1034466423 7:151232626-151232648 CCTCCGCCCCGCCCCCTCCCGGG 0: 1
1: 1
2: 31
3: 325
4: 2115
Right 1034466439 7:151232658-151232680 GACCCCGGCCGTCCTTTATCCGG 0: 1
1: 0
2: 0
3: 0
4: 33
1034466423_1034466446 26 Left 1034466423 7:151232626-151232648 CCTCCGCCCCGCCCCCTCCCGGG 0: 1
1: 1
2: 31
3: 325
4: 2115
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466423_1034466444 19 Left 1034466423 7:151232626-151232648 CCTCCGCCCCGCCCCCTCCCGGG 0: 1
1: 1
2: 31
3: 325
4: 2115
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466423 Original CRISPR CCCGGGAGGGGGCGGGGCGG AGG (reversed) Exonic