ID: 1034466425

View in Genome Browser
Species Human (GRCh38)
Location 7:151232629-151232651
Sequence CGTCCCGGGAGGGGGCGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1057
Summary {0: 1, 1: 1, 2: 3, 3: 108, 4: 944}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466425_1034466446 23 Left 1034466425 7:151232629-151232651 CCGCCCCGCCCCCTCCCGGGACG 0: 1
1: 1
2: 3
3: 108
4: 944
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466425_1034466439 6 Left 1034466425 7:151232629-151232651 CCGCCCCGCCCCCTCCCGGGACG 0: 1
1: 1
2: 3
3: 108
4: 944
Right 1034466439 7:151232658-151232680 GACCCCGGCCGTCCTTTATCCGG 0: 1
1: 0
2: 0
3: 0
4: 33
1034466425_1034466444 16 Left 1034466425 7:151232629-151232651 CCGCCCCGCCCCCTCCCGGGACG 0: 1
1: 1
2: 3
3: 108
4: 944
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466425_1034466436 -9 Left 1034466425 7:151232629-151232651 CCGCCCCGCCCCCTCCCGGGACG 0: 1
1: 1
2: 3
3: 108
4: 944
Right 1034466436 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 20
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466425 Original CRISPR CGTCCCGGGAGGGGGCGGGG CGG (reversed) Exonic