ID: 1034466426

View in Genome Browser
Species Human (GRCh38)
Location 7:151232632-151232654
Sequence CGGCGTCCCGGGAGGGGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 6, 3: 60, 4: 477}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466426_1034466444 13 Left 1034466426 7:151232632-151232654 CCCCGCCCCCTCCCGGGACGCCG 0: 1
1: 0
2: 6
3: 60
4: 477
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466426_1034466439 3 Left 1034466426 7:151232632-151232654 CCCCGCCCCCTCCCGGGACGCCG 0: 1
1: 0
2: 6
3: 60
4: 477
Right 1034466439 7:151232658-151232680 GACCCCGGCCGTCCTTTATCCGG 0: 1
1: 0
2: 0
3: 0
4: 33
1034466426_1034466446 20 Left 1034466426 7:151232632-151232654 CCCCGCCCCCTCCCGGGACGCCG 0: 1
1: 0
2: 6
3: 60
4: 477
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466426 Original CRISPR CGGCGTCCCGGGAGGGGGCG GGG (reversed) Exonic