ID: 1034466434

View in Genome Browser
Species Human (GRCh38)
Location 7:151232640-151232662
Sequence GGGTCTCCCGGCGTCCCGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466434_1034466451 26 Left 1034466434 7:151232640-151232662 CCTCCCGGGACGCCGGGAGACCC 0: 1
1: 0
2: 4
3: 12
4: 118
Right 1034466451 7:151232689-151232711 GGCCCCCGGCCCTGAAACCCGGG 0: 1
1: 0
2: 2
3: 20
4: 241
1034466434_1034466446 12 Left 1034466434 7:151232640-151232662 CCTCCCGGGACGCCGGGAGACCC 0: 1
1: 0
2: 4
3: 12
4: 118
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466434_1034466444 5 Left 1034466434 7:151232640-151232662 CCTCCCGGGACGCCGGGAGACCC 0: 1
1: 0
2: 4
3: 12
4: 118
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466434_1034466450 25 Left 1034466434 7:151232640-151232662 CCTCCCGGGACGCCGGGAGACCC 0: 1
1: 0
2: 4
3: 12
4: 118
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466434_1034466439 -5 Left 1034466434 7:151232640-151232662 CCTCCCGGGACGCCGGGAGACCC 0: 1
1: 0
2: 4
3: 12
4: 118
Right 1034466439 7:151232658-151232680 GACCCCGGCCGTCCTTTATCCGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466434 Original CRISPR GGGTCTCCCGGCGTCCCGGG AGG (reversed) Exonic