ID: 1034466436

View in Genome Browser
Species Human (GRCh38)
Location 7:151232643-151232665
Sequence CCCGGGACGCCGGGAGACCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 318}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466421_1034466436 -1 Left 1034466421 7:151232621-151232643 CCACGCCTCCGCCCCGCCCCCTC 0: 1
1: 5
2: 52
3: 435
4: 2842
Right 1034466436 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 20
4: 318
1034466419_1034466436 1 Left 1034466419 7:151232619-151232641 CCCCACGCCTCCGCCCCGCCCCC 0: 1
1: 3
2: 37
3: 249
4: 1927
Right 1034466436 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 20
4: 318
1034466423_1034466436 -6 Left 1034466423 7:151232626-151232648 CCTCCGCCCCGCCCCCTCCCGGG 0: 1
1: 1
2: 31
3: 325
4: 2115
Right 1034466436 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 20
4: 318
1034466425_1034466436 -9 Left 1034466425 7:151232629-151232651 CCGCCCCGCCCCCTCCCGGGACG 0: 1
1: 1
2: 3
3: 108
4: 944
Right 1034466436 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 20
4: 318
1034466416_1034466436 30 Left 1034466416 7:151232590-151232612 CCAGGCGCGTGCGGGACGCCGCT 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1034466436 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 20
4: 318
1034466420_1034466436 0 Left 1034466420 7:151232620-151232642 CCCACGCCTCCGCCCCGCCCCCT 0: 1
1: 0
2: 8
3: 132
4: 1122
Right 1034466436 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 20
4: 318
1034466418_1034466436 12 Left 1034466418 7:151232608-151232630 CCGCTCTTGGTCCCCACGCCTCC 0: 1
1: 0
2: 8
3: 375
4: 665
Right 1034466436 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 20
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466436 Original CRISPR CCCGGGACGCCGGGAGACCC CGG Exonic