ID: 1034466438

View in Genome Browser
Species Human (GRCh38)
Location 7:151232652-151232674
Sequence AAAGGACGGCCGGGGTCTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466438_1034466446 0 Left 1034466438 7:151232652-151232674 CCGGGAGACCCCGGCCGTCCTTT 0: 1
1: 0
2: 1
3: 14
4: 90
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466438_1034466451 14 Left 1034466438 7:151232652-151232674 CCGGGAGACCCCGGCCGTCCTTT 0: 1
1: 0
2: 1
3: 14
4: 90
Right 1034466451 7:151232689-151232711 GGCCCCCGGCCCTGAAACCCGGG 0: 1
1: 0
2: 2
3: 20
4: 241
1034466438_1034466459 29 Left 1034466438 7:151232652-151232674 CCGGGAGACCCCGGCCGTCCTTT 0: 1
1: 0
2: 1
3: 14
4: 90
Right 1034466459 7:151232704-151232726 AACCCGGGCCTCCTCCCCGAGGG 0: 1
1: 0
2: 1
3: 11
4: 157
1034466438_1034466450 13 Left 1034466438 7:151232652-151232674 CCGGGAGACCCCGGCCGTCCTTT 0: 1
1: 0
2: 1
3: 14
4: 90
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466438_1034466458 28 Left 1034466438 7:151232652-151232674 CCGGGAGACCCCGGCCGTCCTTT 0: 1
1: 0
2: 1
3: 14
4: 90
Right 1034466458 7:151232703-151232725 AAACCCGGGCCTCCTCCCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1034466438_1034466444 -7 Left 1034466438 7:151232652-151232674 CCGGGAGACCCCGGCCGTCCTTT 0: 1
1: 0
2: 1
3: 14
4: 90
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466438 Original CRISPR AAAGGACGGCCGGGGTCTCC CGG (reversed) Exonic