ID: 1034466442

View in Genome Browser
Species Human (GRCh38)
Location 7:151232662-151232684
Sequence GACACCGGATAAAGGACGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466442_1034466450 3 Left 1034466442 7:151232662-151232684 CCGGCCGTCCTTTATCCGGTGTC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466442_1034466462 25 Left 1034466442 7:151232662-151232684 CCGGCCGTCCTTTATCCGGTGTC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1034466462 7:151232710-151232732 GGCCTCCTCCCCGAGGGCCTTGG 0: 1
1: 0
2: 2
3: 53
4: 356
1034466442_1034466451 4 Left 1034466442 7:151232662-151232684 CCGGCCGTCCTTTATCCGGTGTC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1034466451 7:151232689-151232711 GGCCCCCGGCCCTGAAACCCGGG 0: 1
1: 0
2: 2
3: 20
4: 241
1034466442_1034466458 18 Left 1034466442 7:151232662-151232684 CCGGCCGTCCTTTATCCGGTGTC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1034466458 7:151232703-151232725 AAACCCGGGCCTCCTCCCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1034466442_1034466459 19 Left 1034466442 7:151232662-151232684 CCGGCCGTCCTTTATCCGGTGTC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1034466459 7:151232704-151232726 AACCCGGGCCTCCTCCCCGAGGG 0: 1
1: 0
2: 1
3: 11
4: 157
1034466442_1034466446 -10 Left 1034466442 7:151232662-151232684 CCGGCCGTCCTTTATCCGGTGTC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466442_1034466463 26 Left 1034466442 7:151232662-151232684 CCGGCCGTCCTTTATCCGGTGTC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1034466463 7:151232711-151232733 GCCTCCTCCCCGAGGGCCTTGGG 0: 1
1: 0
2: 5
3: 30
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466442 Original CRISPR GACACCGGATAAAGGACGGC CGG (reversed) Exonic