ID: 1034466444

View in Genome Browser
Species Human (GRCh38)
Location 7:151232668-151232690
Sequence GTCCTTTATCCGGTGTCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466431_1034466444 8 Left 1034466431 7:151232637-151232659 CCCCCTCCCGGGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466438_1034466444 -7 Left 1034466438 7:151232652-151232674 CCGGGAGACCCCGGCCGTCCTTT 0: 1
1: 0
2: 1
3: 14
4: 90
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466432_1034466444 7 Left 1034466432 7:151232638-151232660 CCCCTCCCGGGACGCCGGGAGAC 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466437_1034466444 1 Left 1034466437 7:151232644-151232666 CCGGGACGCCGGGAGACCCCGGC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466419_1034466444 26 Left 1034466419 7:151232619-151232641 CCCCACGCCTCCGCCCCGCCCCC 0: 1
1: 3
2: 37
3: 249
4: 1927
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466425_1034466444 16 Left 1034466425 7:151232629-151232651 CCGCCCCGCCCCCTCCCGGGACG 0: 1
1: 1
2: 3
3: 108
4: 944
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466433_1034466444 6 Left 1034466433 7:151232639-151232661 CCCTCCCGGGACGCCGGGAGACC 0: 1
1: 1
2: 0
3: 12
4: 137
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466426_1034466444 13 Left 1034466426 7:151232632-151232654 CCCCGCCCCCTCCCGGGACGCCG 0: 1
1: 0
2: 6
3: 60
4: 477
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466423_1034466444 19 Left 1034466423 7:151232626-151232648 CCTCCGCCCCGCCCCCTCCCGGG 0: 1
1: 1
2: 31
3: 325
4: 2115
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466421_1034466444 24 Left 1034466421 7:151232621-151232643 CCACGCCTCCGCCCCGCCCCCTC 0: 1
1: 5
2: 52
3: 435
4: 2842
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466420_1034466444 25 Left 1034466420 7:151232620-151232642 CCCACGCCTCCGCCCCGCCCCCT 0: 1
1: 0
2: 8
3: 132
4: 1122
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466427_1034466444 12 Left 1034466427 7:151232633-151232655 CCCGCCCCCTCCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 59
4: 391
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466429_1034466444 11 Left 1034466429 7:151232634-151232656 CCGCCCCCTCCCGGGACGCCGGG 0: 1
1: 0
2: 1
3: 45
4: 507
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466435_1034466444 2 Left 1034466435 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 39
4: 274
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1034466434_1034466444 5 Left 1034466434 7:151232640-151232662 CCTCCCGGGACGCCGGGAGACCC 0: 1
1: 0
2: 4
3: 12
4: 118
Right 1034466444 7:151232668-151232690 GTCCTTTATCCGGTGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466444 Original CRISPR GTCCTTTATCCGGTGTCCGC CGG Exonic