ID: 1034466446

View in Genome Browser
Species Human (GRCh38)
Location 7:151232675-151232697
Sequence ATCCGGTGTCCGCCGGCCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 55}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466425_1034466446 23 Left 1034466425 7:151232629-151232651 CCGCCCCGCCCCCTCCCGGGACG 0: 1
1: 1
2: 3
3: 108
4: 944
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466435_1034466446 9 Left 1034466435 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 39
4: 274
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466441_1034466446 -9 Left 1034466441 7:151232661-151232683 CCCGGCCGTCCTTTATCCGGTGT 0: 1
1: 0
2: 0
3: 3
4: 18
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466442_1034466446 -10 Left 1034466442 7:151232662-151232684 CCGGCCGTCCTTTATCCGGTGTC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466433_1034466446 13 Left 1034466433 7:151232639-151232661 CCCTCCCGGGACGCCGGGAGACC 0: 1
1: 1
2: 0
3: 12
4: 137
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466437_1034466446 8 Left 1034466437 7:151232644-151232666 CCGGGACGCCGGGAGACCCCGGC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466434_1034466446 12 Left 1034466434 7:151232640-151232662 CCTCCCGGGACGCCGGGAGACCC 0: 1
1: 0
2: 4
3: 12
4: 118
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466432_1034466446 14 Left 1034466432 7:151232638-151232660 CCCCTCCCGGGACGCCGGGAGAC 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466423_1034466446 26 Left 1034466423 7:151232626-151232648 CCTCCGCCCCGCCCCCTCCCGGG 0: 1
1: 1
2: 31
3: 325
4: 2115
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466431_1034466446 15 Left 1034466431 7:151232637-151232659 CCCCCTCCCGGGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466427_1034466446 19 Left 1034466427 7:151232633-151232655 CCCGCCCCCTCCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 59
4: 391
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466438_1034466446 0 Left 1034466438 7:151232652-151232674 CCGGGAGACCCCGGCCGTCCTTT 0: 1
1: 0
2: 1
3: 14
4: 90
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466426_1034466446 20 Left 1034466426 7:151232632-151232654 CCCCGCCCCCTCCCGGGACGCCG 0: 1
1: 0
2: 6
3: 60
4: 477
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466440_1034466446 -8 Left 1034466440 7:151232660-151232682 CCCCGGCCGTCCTTTATCCGGTG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
1034466429_1034466446 18 Left 1034466429 7:151232634-151232656 CCGCCCCCTCCCGGGACGCCGGG 0: 1
1: 0
2: 1
3: 45
4: 507
Right 1034466446 7:151232675-151232697 ATCCGGTGTCCGCCGGCCCCCGG 0: 1
1: 0
2: 1
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466446 Original CRISPR ATCCGGTGTCCGCCGGCCCC CGG Exonic