ID: 1034466450

View in Genome Browser
Species Human (GRCh38)
Location 7:151232688-151232710
Sequence CGGCCCCCGGCCCTGAAACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466431_1034466450 28 Left 1034466431 7:151232637-151232659 CCCCCTCCCGGGACGCCGGGAGA 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466438_1034466450 13 Left 1034466438 7:151232652-151232674 CCGGGAGACCCCGGCCGTCCTTT 0: 1
1: 0
2: 1
3: 14
4: 90
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466433_1034466450 26 Left 1034466433 7:151232639-151232661 CCCTCCCGGGACGCCGGGAGACC 0: 1
1: 1
2: 0
3: 12
4: 137
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466441_1034466450 4 Left 1034466441 7:151232661-151232683 CCCGGCCGTCCTTTATCCGGTGT 0: 1
1: 0
2: 0
3: 3
4: 18
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466440_1034466450 5 Left 1034466440 7:151232660-151232682 CCCCGGCCGTCCTTTATCCGGTG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466437_1034466450 21 Left 1034466437 7:151232644-151232666 CCGGGACGCCGGGAGACCCCGGC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466435_1034466450 22 Left 1034466435 7:151232643-151232665 CCCGGGACGCCGGGAGACCCCGG 0: 1
1: 0
2: 1
3: 39
4: 274
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466442_1034466450 3 Left 1034466442 7:151232662-151232684 CCGGCCGTCCTTTATCCGGTGTC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466443_1034466450 -1 Left 1034466443 7:151232666-151232688 CCGTCCTTTATCCGGTGTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466434_1034466450 25 Left 1034466434 7:151232640-151232662 CCTCCCGGGACGCCGGGAGACCC 0: 1
1: 0
2: 4
3: 12
4: 118
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466432_1034466450 27 Left 1034466432 7:151232638-151232660 CCCCTCCCGGGACGCCGGGAGAC 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155
1034466445_1034466450 -5 Left 1034466445 7:151232670-151232692 CCTTTATCCGGTGTCCGCCGGCC 0: 1
1: 0
2: 1
3: 2
4: 26
Right 1034466450 7:151232688-151232710 CGGCCCCCGGCCCTGAAACCCGG 0: 1
1: 0
2: 1
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466450 Original CRISPR CGGCCCCCGGCCCTGAAACC CGG Exonic