ID: 1034466747

View in Genome Browser
Species Human (GRCh38)
Location 7:151234174-151234196
Sequence TCTAGCCGAGCTCTGGAATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466747_1034466755 24 Left 1034466747 7:151234174-151234196 CCAGATTCCAGAGCTCGGCTAGA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1034466755 7:151234221-151234243 CCGGATTGTCCCCTACTACAGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1034466747_1034466750 5 Left 1034466747 7:151234174-151234196 CCAGATTCCAGAGCTCGGCTAGA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1034466750 7:151234202-151234224 GTGATGAAGACTTCAAACCCCGG 0: 1
1: 0
2: 1
3: 11
4: 128
1034466747_1034466753 23 Left 1034466747 7:151234174-151234196 CCAGATTCCAGAGCTCGGCTAGA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG 0: 1
1: 0
2: 0
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466747 Original CRISPR TCTAGCCGAGCTCTGGAATC TGG (reversed) Exonic
913971850 1:143422517-143422539 TCCAGCCGACCTCTGGGCTCAGG - Intergenic
914066229 1:144248130-144248152 TCCAGCCGACCTCTGGGCTCAGG - Intergenic
914112924 1:144718224-144718246 TCCAGCCGACCTCTGGGCTCAGG + Intergenic
914459037 1:147865264-147865286 TCTCGCCAGGCTTTGGAATCAGG - Intergenic
920691656 1:208151443-208151465 TCTCACCAAGCTCTGGAATAGGG + Intronic
924767407 1:247046707-247046729 CCTAGCGGAGCTGTGGAAACAGG + Intronic
1065858905 10:29854069-29854091 ACCAGCAGTGCTCTGGAATCAGG + Intergenic
1067525383 10:47035413-47035435 TCTCGCCGACCCCAGGAATCAGG - Intergenic
1074192254 10:111148293-111148315 TCTTCCCGAGCTTTGGAAGCAGG + Intergenic
1074715917 10:116218528-116218550 TCTGGAGGAGCTCTGGACTCTGG - Intronic
1075256126 10:120927060-120927082 TCTAAACGAGCCCTGCAATCTGG - Intergenic
1075852410 10:125600038-125600060 TCTAGCCCAGTTCAGGAAACTGG + Intronic
1083522143 11:63324102-63324124 TCTTGCCAAGGTCTGGTATCAGG - Intronic
1083928831 11:65827164-65827186 TCCAGCTCAGCTCTGGAGTCAGG + Intronic
1084447125 11:69210132-69210154 CCAAGCCAAGCTCTGCAATCTGG - Intergenic
1084930425 11:72551328-72551350 TCCAGCAGAGCTTTGGCATCTGG + Intergenic
1095719989 12:45390157-45390179 ACGACCCGAGCTCAGGAATCTGG - Intronic
1099090042 12:78295204-78295226 TCTTGCAGATTTCTGGAATCTGG + Intergenic
1101579350 12:106027757-106027779 TCTTGCCCAGCCCTGGAATGAGG + Intergenic
1104221322 12:126787444-126787466 ACTAGCCGAGCTCTGGGAGCAGG + Intergenic
1107323696 13:39216725-39216747 TACAGCAGAGCTCTGGAGTCTGG + Intergenic
1109660026 13:65445058-65445080 ACTGGCTGAGCTCTGCAATCAGG - Intergenic
1110963114 13:81656462-81656484 TCTTGTCTAGCTTTGGAATCAGG + Intergenic
1121358242 14:93232474-93232496 TCTAGCAGAGCCTTGGATTCTGG - Intergenic
1123102405 14:105813683-105813705 TCTTGCACAGCTCTGGAAGCTGG - Intergenic
1129352512 15:74964733-74964755 TTTAGCCTATCTCTGAAATCTGG - Intronic
1132140172 15:99385864-99385886 TCAAACTGAGCACTGGAATCAGG - Intronic
1137340599 16:47599798-47599820 TCTAGCCTAGCTTTGTTATCTGG + Intronic
1137549423 16:49427231-49427253 GCGAGCCAACCTCTGGAATCAGG - Intergenic
1137755031 16:50894360-50894382 GCTTGCTGAGCTGTGGAATCTGG - Intergenic
1140312117 16:73859567-73859589 TCCAGCCTTGCTCTGGAATTTGG + Intergenic
1142940510 17:3376755-3376777 TCTAGCTGACCTCTGTAATAAGG - Intergenic
1143894790 17:10127661-10127683 TCCATCAGAGCCCTGGAATCGGG - Intronic
1144786083 17:17832404-17832426 TCTAGCCCAGCTCTGCACTCTGG + Intronic
1157353901 18:46916565-46916587 TATAGCAGAGGTCTGGAATAGGG - Intronic
1160352446 18:78195220-78195242 TCAAGCTCACCTCTGGAATCAGG + Intergenic
1165527752 19:36370400-36370422 TCTAGACCTGCTCTGGCATCAGG + Intronic
926780354 2:16465514-16465536 TCTAGACGAGCTCAGCAAACTGG - Intergenic
927359341 2:22214446-22214468 TCTTGTCTGGCTCTGGAATCAGG - Intergenic
930158383 2:48128420-48128442 CCTACCCGTGCTCTGGAATTGGG - Intergenic
934046897 2:88179823-88179845 TCTGGCCCAGCTCTGTAACCAGG - Intronic
934176540 2:89583449-89583471 TCCAGCCGACCTCTGGGCTCAGG - Intergenic
934286850 2:91657810-91657832 TCCAGCCGACCTCTGGGCTCAGG - Intergenic
934605039 2:95688236-95688258 AGTAGCCTAGATCTGGAATCTGG - Intergenic
936538492 2:113330778-113330800 AGTAGCCTAGATCTGGAATCTGG - Intergenic
937384666 2:121417625-121417647 TCTAGCAGGGCTTTGGCATCTGG + Intronic
947207396 2:227674463-227674485 TCCAGTCTAGCTCTGGAATCTGG - Intergenic
948751045 2:240133446-240133468 TCTTGCCCAGCTCTGAAATCAGG - Intronic
1175254414 20:57630601-57630623 TTTAGCCCAGCTCTAGACTCTGG + Intergenic
1175372525 20:58501539-58501561 TCTTGCCCAGCTCTGGAGGCTGG - Intronic
1178786320 21:35657000-35657022 TCTAACATAGCGCTGGAATCCGG + Intronic
1183028730 22:35085942-35085964 TCAGGCCGAGCTCTGAAATAGGG + Exonic
1184496621 22:44846053-44846075 TTGAGCCGAGCTCTGGAGGCTGG - Intronic
953988146 3:47461523-47461545 TCTCTCCTAGCTCTGAAATCTGG - Intronic
956213516 3:66825586-66825608 TCTAGCAGAACTCTGGACTTAGG + Intergenic
956884678 3:73547188-73547210 CCTAGCCGAACTCTGGAAACAGG + Intronic
966101007 3:176269132-176269154 ACTGGCTGAGCTCTGGAATTAGG + Intergenic
972359399 4:38313714-38313736 TCTAACCTGGCTCTGGAGTCTGG - Intergenic
977537334 4:98269995-98270017 TCTATCAGAGTTCTGGAGTCTGG + Intronic
979785334 4:124710740-124710762 TGTTGCTGAGCTGTGGAATCAGG - Exonic
986049578 5:4076423-4076445 ATTGGCTGAGCTCTGGAATCAGG + Intergenic
990774225 5:59287118-59287140 TAAAGCCAAGCCCTGGAATCAGG - Intronic
993989350 5:94637389-94637411 ACTGGCTGAGCTCTGCAATCAGG + Intronic
997363604 5:133311379-133311401 TCAAGCAAAGCTCTGGAACCTGG + Intronic
999911721 5:156209254-156209276 TCTAGCACTGGTCTGGAATCTGG - Intronic
1012597332 6:101055283-101055305 TCTAGCAGAGCTGTGGAAAAAGG - Intergenic
1013086837 6:106864255-106864277 TCAAGCCCAGCTGTGGACTCAGG - Intergenic
1013749639 6:113389406-113389428 TCTAGCCTAGCTCCTCAATCTGG + Intergenic
1016481572 6:144487589-144487611 TCTGGCCAAGCTCTCGAATCTGG - Exonic
1018778018 6:167036306-167036328 TCCAGTGAAGCTCTGGAATCAGG - Intronic
1020820990 7:12967297-12967319 TATAGCTGAGGTCTTGAATCTGG - Intergenic
1020992782 7:15221309-15221331 TCTAGCAAAACTTTGGAATCTGG + Intronic
1024897269 7:54274814-54274836 ACTGGCTGAGCTCTGCAATCAGG + Intergenic
1033274228 7:139959044-139959066 CCTAGCCTGGCTGTGGAATCAGG + Intronic
1034466747 7:151234174-151234196 TCTAGCCGAGCTCTGGAATCTGG - Exonic
1035187152 7:157135451-157135473 TCTCTCACAGCTCTGGAATCTGG + Intergenic
1040511480 8:48100093-48100115 TCTGGCCAAGTCCTGGAATCAGG + Intergenic
1044977458 8:97679055-97679077 TGTACTCGTGCTCTGGAATCTGG - Intronic
1047190501 8:122674851-122674873 TTTGGCTGAGCTCTGGAATTGGG - Intergenic
1048776960 8:137957493-137957515 TCTAGCAGATTTCTGGAATGTGG + Intergenic
1055218928 9:73904323-73904345 TTCAGCTCAGCTCTGGAATCTGG - Intergenic
1058074907 9:100641034-100641056 TGTAGCTGAGCTCTGGCAGCAGG - Intergenic
1062376138 9:136262707-136262729 CCATGCCCAGCTCTGGAATCAGG + Intergenic
1198671673 X:139087789-139087811 TCTAGCTGGGTTTTGGAATCAGG - Intronic
1200359899 X:155593259-155593281 ACTGGCTGAGCTCTGAAATCAGG - Intronic