ID: 1034466748

View in Genome Browser
Species Human (GRCh38)
Location 7:151234181-151234203
Sequence ACTTTGGTCTAGCCGAGCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466748_1034466753 16 Left 1034466748 7:151234181-151234203 CCAGAGCTCGGCTAGACCAAAGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
1034466748_1034466755 17 Left 1034466748 7:151234181-151234203 CCAGAGCTCGGCTAGACCAAAGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1034466755 7:151234221-151234243 CCGGATTGTCCCCTACTACAGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1034466748_1034466750 -2 Left 1034466748 7:151234181-151234203 CCAGAGCTCGGCTAGACCAAAGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1034466750 7:151234202-151234224 GTGATGAAGACTTCAAACCCCGG 0: 1
1: 0
2: 1
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466748 Original CRISPR ACTTTGGTCTAGCCGAGCTC TGG (reversed) Exonic
905092641 1:35441797-35441819 ACTTTAGGCTAGCCAGGCTCAGG - Intronic
908100692 1:60788034-60788056 GCCTTGGTCTGGCCCAGCTCAGG + Intergenic
911674398 1:100642796-100642818 ACTTTGGCCTTGCATAGCTCTGG - Intergenic
913957630 1:143319316-143319338 ACGTTGGTCCAGCCCTGCTCTGG - Intergenic
914051941 1:144144680-144144702 ACGTTGGTCCAGCCCTGCTCTGG - Intergenic
914127256 1:144821861-144821883 ACGTTGGTCCAGCCCTGCTCTGG + Intergenic
915044815 1:153003324-153003346 ACCTTGGTGTAGCCTGGCTCAGG - Exonic
915044832 1:153003420-153003442 ACTTTGGTGTATCCTTGCTCAGG - Exonic
918211884 1:182358428-182358450 ACTCTAGTCTAGCCAAGCCCAGG - Intergenic
920176340 1:204104265-204104287 GGTCTGGTCTAGCCCAGCTCAGG - Intronic
924121476 1:240803730-240803752 ACTCTGGTCTACCGCAGCTCAGG + Intronic
1063123870 10:3123643-3123665 ACTGTGGAATACCCGAGCTCAGG - Intronic
1064032672 10:11893167-11893189 ACTCTGGTCTAGTCTGGCTCAGG - Intergenic
1066961577 10:42231501-42231523 ACTTTGGCCCAGCCCTGCTCTGG - Intergenic
1069344035 10:67446325-67446347 AGTTCGGTCTAGGAGAGCTCAGG - Intronic
1073468168 10:103706459-103706481 ACCTTGTTCTAGCAGAGCACTGG + Intronic
1076204714 10:128587884-128587906 ACTATGGTCTGGGCTAGCTCGGG - Intergenic
1079093031 11:17494044-17494066 AATTTGGTCTCTCCCAGCTCTGG - Intronic
1085829250 11:79882306-79882328 ACTGTGGCCTGGCCCAGCTCTGG - Intergenic
1091357320 11:134947303-134947325 ACTCTGGTCTACCTGAGGTCAGG - Intergenic
1096101260 12:48971705-48971727 GCTTTGCTCTCACCGAGCTCAGG + Exonic
1113589338 13:111487240-111487262 GCTTTGCTCTTGCCGAGCACAGG - Intergenic
1119735646 14:76980070-76980092 ACGTTGGTCAAGCTGACCTCAGG + Intergenic
1124623571 15:31294717-31294739 ACAGTGGTCTTGCCGAGCTGAGG - Intergenic
1129496765 15:75990320-75990342 ACTCTGGTCTTGCTGAGCTGAGG - Intronic
1129912064 15:79236081-79236103 ACTTGGGTCAAGTCCAGCTCAGG + Intergenic
1130961353 15:88660526-88660548 ACCTTGGTCTCGCAAAGCTCTGG - Intergenic
1132810574 16:1794778-1794800 ACTGTGGTCTCCCCGAGCCCTGG - Intronic
1133186927 16:4106577-4106599 ACTCTGGACTAGCTGAGCTTAGG - Intronic
1149850246 17:60029792-60029814 ACCTTGGTTTGGCAGAGCTCCGG - Intergenic
1149859920 17:60116732-60116754 ACCTTGGTTTGGCAGAGCTCCGG + Intergenic
1157627442 18:49062356-49062378 ACTCTTATCTAGCCCAGCTCAGG + Intronic
1162565519 19:11444225-11444247 ACTTGGGTCTGGGCAAGCTCAGG + Intronic
1165071100 19:33255269-33255291 ACTTGGGTCTATCTGAGCCCAGG + Intergenic
1168475022 19:56669304-56669326 ACTTAGGGTTTGCCGAGCTCTGG - Intronic
1202691339 1_KI270712v1_random:97104-97126 ACGTTGGTCCAGCCCTGCTCTGG - Intergenic
926112024 2:10189565-10189587 TCTTTGGTCTGGGGGAGCTCAGG + Intronic
926803267 2:16681410-16681432 CCTTGGGTCTAGCTGGGCTCTGG - Intergenic
927102859 2:19801211-19801233 CATTTGGTCTAGCAGAGGTCGGG - Intergenic
928113048 2:28525791-28525813 TCTTTGGCCTAGCCTTGCTCTGG - Intronic
934273944 2:91563638-91563660 ACGTTGGTCCAGCCCTGCTCTGG - Intergenic
939669022 2:144986871-144986893 ACTTTTGTCTATCTGAGCTCTGG + Intergenic
946220467 2:218221550-218221572 AGTTTGGTCCAGCACAGCTCTGG - Intronic
1175917149 20:62431605-62431627 ACTGTGGTCCAGCCGTGCACTGG - Intergenic
983239030 4:165210023-165210045 CCTCTGTTCTAGCCCAGCTCTGG - Exonic
986011256 5:3717800-3717822 ACTCTGGGGTAGCCGAGGTCAGG - Intergenic
1001230378 5:169982126-169982148 ACTGTGGTCCAGCCAAGCACGGG - Intronic
1001752584 5:174142873-174142895 CCTTTGGTCTTGCTCAGCTCTGG + Intronic
1018860509 6:167707867-167707889 ACTCTGGTCTATCCGAGGCCTGG + Intergenic
1034466748 7:151234181-151234203 ACTTTGGTCTAGCCGAGCTCTGG - Exonic
1036509707 8:9388944-9388966 AATTTGGTCTTTCCCAGCTCTGG - Intergenic
1037720590 8:21440111-21440133 ACTTTGGTTTAGCAGAGCAATGG + Intergenic
1059892455 9:118818014-118818036 ATTTTAGTCTATCTGAGCTCAGG - Intergenic
1062561471 9:137144117-137144139 CCTTTGGACAAGCTGAGCTCAGG - Intronic
1189052362 X:37659596-37659618 TCGATGGTCTCGCCGAGCTCAGG - Exonic
1194476010 X:94360777-94360799 ACCTGGGTCTAGCCGAGCTAAGG - Intergenic
1197352624 X:125396860-125396882 ACTTTGGTCTAGATAAACTCAGG - Intergenic
1198021447 X:132662422-132662444 ATATTGCTCTAGCAGAGCTCAGG - Intronic