ID: 1034466749

View in Genome Browser
Species Human (GRCh38)
Location 7:151234197-151234219
Sequence GTTTGAAGTCTTCATCACTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466749_1034466755 1 Left 1034466749 7:151234197-151234219 CCAAAGTGATGAAGACTTCAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1034466755 7:151234221-151234243 CCGGATTGTCCCCTACTACAGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1034466749_1034466760 25 Left 1034466749 7:151234197-151234219 CCAAAGTGATGAAGACTTCAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1034466760 7:151234245-151234267 CCCCAACAAGCCCTACAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 98
1034466749_1034466753 0 Left 1034466749 7:151234197-151234219 CCAAAGTGATGAAGACTTCAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG 0: 1
1: 0
2: 0
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466749 Original CRISPR GTTTGAAGTCTTCATCACTT TGG (reversed) Exonic
901318181 1:8323066-8323088 GTTTGCAATCTGCACCACTTAGG - Intronic
906068453 1:42999627-42999649 GATTGAATTCCTCATCAGTTAGG - Intergenic
907068721 1:51514780-51514802 GCTTGAAATGTTCAGCACTTGGG - Intronic
907348570 1:53805464-53805486 GTGTGTGGTCTTCAGCACTTTGG - Intronic
907623281 1:56004019-56004041 GTTTGAAGTTTTTATGATTTTGG + Intergenic
908349778 1:63273547-63273569 GTTTGTAGTCTTAGTTACTTAGG + Intergenic
911925558 1:103826659-103826681 ACTTGAAGTGTACATCACTTGGG - Intergenic
912310153 1:108612413-108612435 CACTGAAGTATTCATCACTTAGG + Intronic
916654541 1:166862331-166862353 GTTTCAAGTCGTCATCATCTTGG + Exonic
916753003 1:167740576-167740598 GTTTGATGTCTGTATGACTTCGG + Intronic
916822403 1:168412147-168412169 TTTTGAAGACTTTGTCACTTTGG + Intergenic
917384547 1:174456352-174456374 TTTTGATGTCTTCATCATTAAGG - Intronic
918686932 1:187428684-187428706 TTATGGAGGCTTCATCACTTAGG + Intergenic
921467690 1:215509722-215509744 TATTGAAGGCTTCATCACATAGG + Intergenic
921670749 1:217921186-217921208 ATTCGAAGTCTGCATCACCTTGG - Intergenic
921925694 1:220708443-220708465 TTTTGGAGGCTTCATCACATGGG - Intergenic
924436042 1:244043936-244043958 GGTTGAAGGCTGCATTACTTTGG - Intergenic
924829757 1:247580828-247580850 GTTTAATGTCTTCAACAGTTTGG - Intergenic
1062783493 10:239458-239480 CTTTGAACTCTTCATAACTTCGG - Exonic
1062921372 10:1282571-1282593 GTTTAATGTTTTAATCACTTGGG + Intronic
1063038507 10:2313794-2313816 GTTTGCATTCTTAAGCACTTTGG - Intergenic
1065996748 10:31066445-31066467 ATTTGATGTCATCATCATTTTGG + Intergenic
1067578642 10:47424822-47424844 GTTTTAAGTCTTCATAGATTAGG + Intergenic
1067694902 10:48527728-48527750 GTTTGGGGTCATCATCAATTTGG - Intronic
1069402093 10:68059362-68059384 CTTTCAAGTCTTCATCATATAGG + Intronic
1071027124 10:81128324-81128346 GCTAGCAGTCTTCATCACATTGG - Intergenic
1071078592 10:81783614-81783636 TTATGGAATCTTCATCACTTAGG + Intergenic
1074478938 10:113800765-113800787 GTTTAAAATCATCAGCACTTTGG + Intergenic
1075432170 10:122395156-122395178 GTTTGGAGACTAGATCACTTTGG + Intronic
1075932539 10:126311652-126311674 TTATGGAGGCTTCATCACTTTGG - Intronic
1076418121 10:130306984-130307006 GTGTGAGGTTTTCATCATTTGGG + Intergenic
1080507587 11:32932094-32932116 GTTTGTTGCCTTCAGCACTTGGG + Exonic
1081951006 11:47042904-47042926 GCTTGCAGTGTTCATGACTTGGG + Intronic
1083063519 11:59899143-59899165 GTTTGCATTCTTCATGACTGAGG - Intergenic
1083359692 11:62097589-62097611 GTTTGTAGGCTTCTTCACTCAGG + Intergenic
1083359743 11:62098266-62098288 GTTTGTAGGCTTCTTCACTCAGG - Intergenic
1085821414 11:79797649-79797671 GTTTGAAGACTTGACCACTATGG + Intergenic
1086406897 11:86506265-86506287 GGTTGTGGTCTTCATCTCTTTGG + Intronic
1089620415 11:119718862-119718884 ATTTGAAGTCTGAAACACTTTGG - Intronic
1090874166 11:130774207-130774229 GTTTGAAGGCCTCTGCACTTCGG - Intergenic
1092039133 12:5368094-5368116 CTTTCAAGTCGTCATCACTTTGG + Intergenic
1094605727 12:31947435-31947457 GTTGGTTGTCATCATCACTTAGG + Intergenic
1094766096 12:33596365-33596387 TTTTGCAGTCTTCAGCATTTTGG + Intergenic
1099407139 12:82278417-82278439 TTTATAAGTCTTTATCACTTGGG + Intronic
1099710496 12:86218256-86218278 CTTTGAAGTCTTTATCACTCTGG + Intronic
1099985718 12:89660808-89660830 GTTTGAGGTCTTCCTCATCTGGG - Intronic
1100682130 12:96936506-96936528 GTTTGAAGTGTTAATAACTCTGG + Intronic
1101607397 12:106258062-106258084 TTTTGAACCCTACATCACTTGGG - Intronic
1104514238 12:129409249-129409271 ATTTGAAGTGTTCATTACATAGG + Intronic
1106558453 13:30829558-30829580 CTATGAAATCTTCAGCACTTGGG + Intergenic
1107191021 13:37586113-37586135 GTTTAATGTCTTCATCTCTAAGG - Intronic
1108669713 13:52673134-52673156 GTTTTAAGTCTTCATGATTCGGG - Intronic
1108917138 13:55628928-55628950 GTTTGAAGCATTCATCAATGTGG + Intergenic
1109185789 13:59266099-59266121 GGTTAAAGTCTTCATGATTTAGG + Intergenic
1109366356 13:61361824-61361846 GTTTGAAGGTTTCCTCTCTTAGG - Intergenic
1110300305 13:73918899-73918921 GTTTCAGGTCTTCAGAACTTTGG - Intronic
1111142402 13:84136848-84136870 GTTTAAAGCCTTCTTCCCTTGGG + Intergenic
1114155082 14:20093386-20093408 GTTAGAATTCATCAGCACTTGGG + Intergenic
1115413424 14:33102340-33102362 GTCAGAAGTCTTAATCACTATGG - Intronic
1117997661 14:61493110-61493132 GTTTGAATTCTGGGTCACTTAGG + Intronic
1118657938 14:67973514-67973536 GTTTGAAAACTTCATCAAATGGG - Intronic
1119988349 14:79166196-79166218 GTCTGAAATCTTCTTCCCTTTGG + Intronic
1124391690 15:29264449-29264471 TTTTGAAACCTTGATCACTTTGG - Intronic
1126381239 15:48049413-48049435 GTTTGAAGTATTCTTCACATAGG + Intergenic
1130362368 15:83201948-83201970 GTTTATAATCTTCATTACTTTGG - Intronic
1131142265 15:89986829-89986851 GTTTGATGTCTTCATCTTTCAGG - Intergenic
1133603909 16:7367294-7367316 GTTTGTAGTCATCATCATGTTGG + Intronic
1135935224 16:26774188-26774210 GATGGAAGTCTTCATGACTTCGG + Intergenic
1138858049 16:60719753-60719775 GGTTAAAATTTTCATCACTTTGG + Intergenic
1139762358 16:69195804-69195826 GATTGCAGTCTCCATCATTTTGG - Intronic
1140307912 16:73820810-73820832 GATTGAAGTCTCAATAACTTTGG - Intergenic
1140389392 16:74572194-74572216 TTATGGAGTCTTCATTACTTAGG - Intronic
1141450126 16:84093853-84093875 GTTTGAAGAAATCATCATTTTGG + Intronic
1144837840 17:18166602-18166624 GTTTGAAGTGTTCATGATTCAGG + Intronic
1144970028 17:19102636-19102658 GTTTGGAATCTTCACCACTTTGG + Intergenic
1144977888 17:19149429-19149451 GTTTGGAATCTTCACCACTTTGG - Intronic
1144990333 17:19228804-19228826 GTTTGGAATCTTCACCACTTTGG + Intronic
1145327869 17:21846462-21846484 GGTGGAATTTTTCATCACTTTGG + Intergenic
1145393291 17:22473811-22473833 TTTTAAAATCTTTATCACTTGGG - Intergenic
1145694682 17:26777840-26777862 GGTGGAATTTTTCATCACTTTGG + Intergenic
1145803535 17:27708457-27708479 GTTTGTAGTATTCATAGCTTTGG + Intergenic
1151279290 17:73060443-73060465 CTTTGAAGTCTTTATCACTCTGG + Intronic
1203192503 17_KI270729v1_random:202688-202710 GGTGGAATTTTTCATCACTTTGG + Intergenic
1203201868 17_KI270730v1_random:2123-2145 GGTGGAATTTTTCATCACTTTGG + Intergenic
1154936822 18:21067810-21067832 GGTTGAAATCTTCATGACCTCGG - Intronic
1155548050 18:26934772-26934794 GAATCAAGTCTACATCACTTCGG + Intronic
1156423529 18:36982242-36982264 GTTTATAGTTTTCATCACTTTGG - Intronic
1156435119 18:37118690-37118712 GTTGGAAGTATTCTTCCCTTTGG + Intronic
1156572623 18:38275927-38275949 GTGTCTAGTCTCCATCACTTCGG + Intergenic
1159061235 18:63516473-63516495 TTGTGAAGCCTTCATCAGTTGGG + Intergenic
1159580925 18:70234078-70234100 CTTGGAAGTATTTATCACTTTGG + Intergenic
1160044817 18:75376892-75376914 GTTTGAAGGCTGCATCTCCTGGG + Intergenic
1160188476 18:76695094-76695116 GCTTGAATTCTTCCCCACTTTGG - Intergenic
1162308694 19:9891643-9891665 GTATGAAGCCTCCATCACTGGGG + Intronic
1164036013 19:21456111-21456133 TTTTGAAATCTTTATTACTTTGG - Intronic
1165345498 19:35246366-35246388 GTTGAAAATCTTCATCACATTGG + Intergenic
1167783829 19:51619536-51619558 GTTTAAAATCTTCATACCTTTGG + Intronic
928187738 2:29128383-29128405 CTTTGAAATCTTTGTCACTTTGG - Intronic
932090442 2:68801240-68801262 GTTCAAAGTCTTCATCATATGGG + Intronic
933533694 2:83543952-83543974 GTTAGAGGTGTTCATCTCTTCGG - Intergenic
934075397 2:88424096-88424118 CTCTTAAGTCTTCATCAATTTGG - Intergenic
935113864 2:100117161-100117183 GTTTGATAGCTTCATCAGTTTGG + Intronic
935153202 2:100458175-100458197 TTTGGAAATCTTTATCACTTTGG + Intergenic
937088375 2:119187211-119187233 TTATGGAGTCTTCATCACATAGG + Intergenic
945418526 2:209604972-209604994 GTTTAAAATCTTCATCTCTGTGG - Intronic
945420924 2:209635165-209635187 TTTTGAAGTCATTATCATTTTGG - Intronic
947271357 2:228339039-228339061 GTTTGAAGTCTTAATCTCTAAGG + Intergenic
1177348475 21:19902653-19902675 GTTTGAAGTCATGATCAAGTTGG + Intergenic
1183353555 22:37346591-37346613 GTTTGGAGACTTAATCACTGGGG + Intergenic
1183837518 22:40468187-40468209 GTTTGATGTGTTCATTTCTTGGG - Intronic
949256859 3:2058703-2058725 GGTTGAAATCTGAATCACTTGGG - Intergenic
951422872 3:22508822-22508844 GTTAGAAGTTTGCATCACTAGGG + Intergenic
952048385 3:29352545-29352567 ATTTGAGGTATCCATCACTTTGG + Intronic
953915575 3:46918576-46918598 GTCTGAAGTCTTCATAAGTCTGG + Intergenic
954816490 3:53285498-53285520 TTTTCAAGTCTCCATGACTTGGG + Exonic
956040575 3:65140890-65140912 GATTGATGTCTTTATCACTCAGG + Intergenic
956691668 3:71883892-71883914 GTTTAAAGTTTTCATCAATTTGG - Intergenic
958027828 3:88069777-88069799 GTTTGCAGTCACCATAACTTTGG - Intronic
962131088 3:132677544-132677566 CTCTTAAGTCTTCATTACTTGGG - Exonic
962182331 3:133221124-133221146 TTATGAAGGCTTCATCACATAGG + Intronic
962871159 3:139494190-139494212 GTTTGAGGTCTTCAACACCCTGG + Intergenic
964023471 3:152042705-152042727 TTTTTAATTCTTCATCATTTGGG - Intergenic
965094582 3:164208643-164208665 ATTTGAAATCTTAAGCACTTAGG + Intergenic
966357890 3:179101365-179101387 GTTTGAAGTTTTCTTCAATGTGG + Intergenic
967066500 3:185921923-185921945 GTGGAAAGTCTTCAGCACTTAGG - Intronic
967332978 3:188310584-188310606 GATTTGAGTTTTCATCACTTTGG + Intronic
967612723 3:191526849-191526871 CTCTGAAGTCTTCATCTCATTGG - Intergenic
968259224 3:197306060-197306082 GTGTGAAGTCTACCTCACTGTGG - Intergenic
969978532 4:11130153-11130175 CTTTGGAGACTTCATCATTTGGG + Intergenic
970018260 4:11537237-11537259 GTGTGTTGTCTTTATCACTTTGG - Intergenic
973108287 4:46368085-46368107 CTTTTATGTCTTCCTCACTTAGG - Intronic
973551912 4:52044071-52044093 ATTTCAAGTCTTCTTCACTAAGG - Intergenic
973891320 4:55370097-55370119 GTTTGCATTCTTCATGACTGAGG - Exonic
974519726 4:62967632-62967654 TTTTGAAATCTTCAGGACTTAGG + Intergenic
974764570 4:66326293-66326315 GTTTGGAATCTTTATCAGTTTGG - Intergenic
976902683 4:90198121-90198143 ATTTGGAGTCTTCATTACCTAGG + Intronic
977407074 4:96613208-96613230 ATTTGAAATTTTCATCACTTAGG + Intergenic
982149935 4:152442747-152442769 CTTTTAAGTGTTCATAACTTGGG - Intronic
983921115 4:173346176-173346198 GATTGCAGCTTTCATCACTTTGG + Intergenic
985159793 4:187032793-187032815 GTGTGACTTCTTCATCTCTTTGG + Intergenic
985188602 4:187346131-187346153 GTTTGCAGTCTCCATGACATAGG + Intergenic
987499962 5:18697247-18697269 ATTTGAAGTCTTCATAAATGAGG - Intergenic
987781201 5:22437758-22437780 GTTTAAAGTATTCTTAACTTAGG + Intronic
990194171 5:53294295-53294317 GTTGGAAGTAATCTTCACTTAGG - Intergenic
990862061 5:60338273-60338295 AGTAGAAGTCTTCATCACTAAGG + Intronic
994654724 5:102577281-102577303 GTTTTAAGAGTTTATCACTTTGG + Intergenic
995450771 5:112297759-112297781 GTTTTAAGTCTTAATGATTTAGG + Intronic
995617464 5:113981523-113981545 ATTTGGGGTGTTCATCACTTTGG + Intergenic
996524758 5:124466768-124466790 GCCTGAAGTCTTCACCACTGGGG + Intergenic
996692292 5:126353073-126353095 GATTTAAGTTTTGATCACTTGGG - Intergenic
998547143 5:143039174-143039196 TTTTGAAGTGTTCATTACTAAGG + Intronic
999878338 5:155833504-155833526 TTTTGATGTCTTCATCTGTTGGG - Intergenic
1001879172 5:175228332-175228354 TTCTGAAGACTTCATCACATAGG - Intergenic
1002975683 6:2073454-2073476 GTTTGGGGTATTCATCACCTTGG + Intronic
1005371106 6:25134135-25134157 TTTTGAAATCCTTATCACTTTGG + Intergenic
1014175780 6:118329709-118329731 TTTTTAAGACTTCATCACTTAGG - Intergenic
1014588342 6:123229612-123229634 GTGTTAAGTCTTCATCTCTTTGG + Intronic
1016228986 6:141778583-141778605 GTTTTATGTCTTCATCGGTTTGG - Intergenic
1016317213 6:142804174-142804196 CTTTGAGCTCTTCATCACTAAGG - Intronic
1021859294 7:24890388-24890410 CTTTGAAGCTTTCCTCACTTAGG - Intronic
1021965072 7:25909765-25909787 TTTTGATGTCTTCATCTCTCTGG - Intergenic
1023306603 7:38836568-38836590 GTTTGCAGTCTGCATGACATGGG - Intronic
1024084314 7:45881013-45881035 GTGGGAAGTGTCCATCACTTTGG - Intergenic
1024402819 7:48944596-48944618 TTTTCAAGTCTTTATAACTTTGG - Intergenic
1025278964 7:57612612-57612634 GGTGGAATTTTTCATCACTTTGG + Intergenic
1025305767 7:57852888-57852910 GGTGGAATTTTTCATCACTTTGG - Intergenic
1026218345 7:68369423-68369445 TTATGAAGACTTCATCACATAGG - Intergenic
1028434511 7:90786462-90786484 GTTTGAAGTTTTCATAAAATAGG + Intronic
1029216776 7:98956256-98956278 GTCTGAAGTCGTCATCAAGTGGG + Exonic
1031367978 7:120926731-120926753 GTTTGAAAAAATCATCACTTGGG - Intergenic
1031720799 7:125173340-125173362 GTTTGCAGTTTTTATTACTTAGG + Intergenic
1032399555 7:131614280-131614302 GTTTGAATTCTTTATCAGGTTGG + Intergenic
1034466749 7:151234197-151234219 GTTTGAAGTCTTCATCACTTTGG - Exonic
1035408351 7:158616613-158616635 GTTTTAAGTCTTTTTCTCTTGGG - Intergenic
1037253121 8:16920197-16920219 GTCTGTGGTCTTCATCATTTTGG + Intergenic
1038588730 8:28815594-28815616 GTCTGAAGTCTGAAACACTTTGG + Intronic
1038779787 8:30560258-30560280 GTTTGAAGTTCTCATCACGCAGG + Intronic
1038967642 8:32593241-32593263 GTTTGAATTCTTCACCCCTCTGG - Intronic
1040493533 8:47946652-47946674 TTTGGAGGTCTTCATCACGTAGG - Intronic
1043991470 8:86760876-86760898 GTTTCAATTCATCATCACATGGG - Intergenic
1044007085 8:86951109-86951131 TTTTTAAGTTTTCAGCACTTAGG + Intronic
1046723089 8:117643447-117643469 GTGTAAAATCTTCATGACTTTGG + Intergenic
1047454899 8:124999451-124999473 GTTCGGGGACTTCATCACTTTGG + Exonic
1047459495 8:125048735-125048757 TTTTGAACTGTTAATCACTTGGG + Intronic
1049054041 8:140220915-140220937 GTTTTGAGTCTTCAGCACATGGG - Intronic
1051483162 9:17579951-17579973 ATTTTAAGTCTTCAACAATTTGG - Intronic
1051568773 9:18531118-18531140 GTTTGAAATATTCATCTCATGGG - Intronic
1053575617 9:39355805-39355827 GTTGGATATCTTCCTCACTTTGG + Exonic
1054097187 9:60914510-60914532 GTTGGATATCTTCCTCACTTTGG + Intergenic
1054118593 9:61190139-61190161 GTTGGATATCTTCCTCACTTTGG + Exonic
1054589164 9:66992425-66992447 GTTGGATATCTTCCTCACTTTGG - Intergenic
1055888383 9:81094922-81094944 GTTCTAAGCCTTCATCAGTTAGG - Intergenic
1056270334 9:84941379-84941401 TTTTGAATTGTTAATCACTTTGG + Intronic
1060143688 9:121232934-121232956 GATAGAAGTTTTCATCCCTTGGG + Intronic
1060312264 9:122472696-122472718 GTTTTAGGTCTTCATCTCCTGGG - Intergenic
1185978015 X:4743247-4743269 TTTTAAGGTCTGCATCACTTGGG - Intergenic
1188099540 X:26066982-26067004 GTGTGAAGTCTCCCTCACTTAGG - Intergenic
1188121023 X:26307804-26307826 AATTGAAGTCTTAATTACTTTGG + Intergenic
1188216505 X:27485005-27485027 GTTTTAAGTCATGAACACTTAGG + Intergenic
1189499115 X:41538372-41538394 GTAGGAAGTCTTCATTAATTTGG - Intronic
1194981803 X:100449207-100449229 GTTTCATCTCTACATCACTTGGG + Intergenic
1196577397 X:117335393-117335415 GTTTGAAGTCTTTTGGACTTTGG - Intergenic
1196910498 X:120480164-120480186 GTTTACAGTCTCCAGCACTTTGG + Intergenic
1197842030 X:130758582-130758604 GTATGAAGTCTTCATTTCTTTGG + Intronic
1198874767 X:141211965-141211987 GGTTTTAGTCTTCATGACTTTGG + Intergenic