ID: 1034466753

View in Genome Browser
Species Human (GRCh38)
Location 7:151234220-151234242
Sequence CCCGGATTGTCCCCTACTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466748_1034466753 16 Left 1034466748 7:151234181-151234203 CCAGAGCTCGGCTAGACCAAAGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
1034466747_1034466753 23 Left 1034466747 7:151234174-151234196 CCAGATTCCAGAGCTCGGCTAGA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
1034466749_1034466753 0 Left 1034466749 7:151234197-151234219 CCAAAGTGATGAAGACTTCAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG 0: 1
1: 0
2: 0
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466753 Original CRISPR CCCGGATTGTCCCCTACTAC AGG Exonic