ID: 1034466753

View in Genome Browser
Species Human (GRCh38)
Location 7:151234220-151234242
Sequence CCCGGATTGTCCCCTACTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034466748_1034466753 16 Left 1034466748 7:151234181-151234203 CCAGAGCTCGGCTAGACCAAAGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
1034466747_1034466753 23 Left 1034466747 7:151234174-151234196 CCAGATTCCAGAGCTCGGCTAGA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
1034466749_1034466753 0 Left 1034466749 7:151234197-151234219 CCAAAGTGATGAAGACTTCAAAC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG 0: 1
1: 0
2: 0
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034466753 Original CRISPR CCCGGATTGTCCCCTACTAC AGG Exonic
910982728 1:92974956-92974978 ACCTGGTGGTCCCCTACTACTGG + Intergenic
1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG + Intronic
1073446712 10:103585262-103585284 CCCGGATCGTCCCCGCCTCCAGG - Intronic
1075975176 10:126688171-126688193 CCCGGATTGTGCACTGCTGCTGG + Intergenic
1083706337 11:64518843-64518865 CCAGAATTGACCCCTACTCCAGG - Intergenic
1089927387 11:122272770-122272792 CACGGATCTTCTCCTACTACAGG - Intergenic
1097061925 12:56291658-56291680 CCCAGATTCTCCCCTAATCCTGG + Intronic
1098791341 12:74828064-74828086 CCAGGATTGTCCCAAACTACTGG - Intergenic
1107320405 13:39180369-39180391 CCCTCATTGTCCCATACCACTGG + Intergenic
1107526964 13:41242482-41242504 CTAGGGTTGTCCACTACTACTGG + Intronic
1110077818 13:71271535-71271557 CCCAGATTGTCCCAAACTGCTGG - Intergenic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1121445004 14:93973156-93973178 CCCTGGTTGTCACCTCCTACAGG - Intronic
1122913610 14:104845547-104845569 CCCGGAGTGTCCCCAACACCAGG - Intergenic
1123934389 15:25187104-25187126 CCCGGGCTGTGCCCTACTGCAGG - Intergenic
1149758741 17:59210118-59210140 CCCGGAGGGTCCCCTACTGAGGG + Exonic
1160706811 19:533713-533735 ACCGGATTATCCCCTAATGCTGG - Intronic
1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG + Intronic
1163852885 19:19675883-19675905 CCCACCTTGTTCCCTACTACAGG - Intronic
925591205 2:5511789-5511811 CCCAGATTGTTCCCAACTACAGG + Intergenic
932417242 2:71580772-71580794 CCCAAATTGTCCCCTACTGAGGG - Intronic
939908300 2:147946489-147946511 CCCACATTGTCCCCTTTTACTGG - Intronic
945054831 2:205859411-205859433 GCCAGAATGTCCCCTCCTACAGG - Intergenic
961952155 3:130761575-130761597 CACTGATTGTCCCCCACAACAGG + Intergenic
965095122 3:164216271-164216293 CCTGGATAGACCCCTACTCCTGG - Intergenic
973695512 4:53486557-53486579 CCCGGAATGTTTCCTACTGCAGG + Intronic
983657821 4:170100796-170100818 CAGTGATTGTCCCCTCCTACAGG + Intergenic
1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG + Intronic
1001706198 5:173742886-173742908 CCAGGATAGTCCCCTACTGATGG + Intergenic
1007807629 6:44462450-44462472 CCCGGGTCATCCCCTACTCCAGG + Intergenic
1012224351 6:96687762-96687784 CCCAGATTGTGCCCCACTATGGG + Intergenic
1026819412 7:73536864-73536886 CCCGGACTTTCCCCTAGGACTGG - Exonic
1027157265 7:75777536-75777558 CCAGGCTTGTCTCCAACTACTGG - Intronic
1032863001 7:135899255-135899277 CCTGGTTTGTCCCCTGCTCCAGG - Intergenic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1037731717 8:21531169-21531191 CCCAGGTTGACTCCTACTACTGG - Intergenic
1058161459 9:101574541-101574563 TCCAGATTGTCCCCTTCTCCTGG - Intronic
1191251902 X:58263802-58263824 CCCTGATTGTCCCCTTCTTCCGG - Intergenic
1195819221 X:108925103-108925125 ATCGGATTTTCCCCTACTGCTGG + Intergenic